Gpr132 (NM_019925) Mouse Untagged Clone

CAT#: MC210087

Gpr132 (untagged) - Mouse G protein-coupled receptor 132 (Gpr132), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gpr132 (NM_019925) Mouse Untagged Clone
Symbol Gpr132
Synonyms G2a
Vector pCMV6-Entry
Sequence Data
>MC210087 representing NM_019925
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGATCAGAACCTACCAATGCAGCAGGAAACACCACACTGGGGGTTACCTCCGTTCTTCAGAGCACCT
CAGTACCTTCTTCTGAGACCTGCCACGTCTCCTACGAGGAGAGCAGAGTGGTCCTGGTGGTGGTGTACAG
TGCCGTGTGCCTGCTGGGCCTACCAGCCAACTGCCTGACTGCCTGGCTGACGCTGCTGCAAGTCCTGCAG
AGGAACGTGCTAGCCGTCTACCTGTTCTGCCTGTCCCTCTGTGAGCTGCTCTACATCAGCACGGTGCCAT
TGTGGATCATCTACATCCAGAATCAGCACAAATGGAACCTGGGTCCGCAGGCCTGCAAGGTGACTGCTTA
CATCTTCTTCTGCAACATCTACATCAGCATCCTCTTGCTCTGCTGCATTTCCTGCGACCGCTACATGGCC
GTGGTCTATGCACTGGAGAGCCGAGGCCACCGCCACCAGAGGACTGCTGTCACCATTTCTGCGTGTGTGA
TTCTTCTTGTTGGACTTGTTAACTATCCAGTGTTTGACATGAAGGTGGAGAAGAGTTTCTGCTTTGAGCC
CCTGAGGATGAACAGCAAGATAGCCGGCTACCACTACCTGCGTTTCACCTTTGGCTTTGCCATCCCTCTC
GGCATCCTGGCGTTCACCAATCACCAGATCTTCCGGAGCATCAAACTCAGTGACAGCCTGAGCGCTGCGC
AGAAGAACAAGGTGAAGCGCTCCGCCATCGCGGTCGTCACCATCTTCCTGGTCTGCTTTGCTCCCTACCA
CGTGGTACTCCTCGTCAAAGCTGCCAGCTTTTCCTTCTACCAAGGAGACATGGATGCCGTGTGTGCCTTT
GAAAGCAGACTGTACACAGTCTCTATGGTGTTTCTGTGCCTGTCTACAGTCAACAGTGTGGCTGACCCCA
TCATCTACGTGCTGGGTACAGACCACTCTCGGCAAGAAGTGTCCAGAATCCACACAGGGTGGAAAAAGTG
GTCCACAAAGACATATGTTACATGCTCAAAGGACTCTGAGGAGACACACTTGCCCACAGAGCTTTCAAAC
ACATACACCTTCCCCAATCCCGCGCACCCTCCAGGATCACAGCCAGCGAAGCTAGGTTTACTGTGCTCGC
CAGAGAGACTGCCTGAGGAGCTCTGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_019925
ORF Size 1149 bp
Insert Size 1149
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019925.4, NP_064309
RefSeq Size 2439
RefSeq ORF 1149
Locus ID 56696
Cytogenetics 12|12 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.