Cited4 (NM_019563) Mouse Untagged Clone

CAT#: MC210030

Cited4 (untagged) - Mouse Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 (Cited4), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cited4
• Synonyms: MRG-2; Mrg2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210030 representing NM_019563
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGACCACCTGATGCTCGCCGAGGGCTACTGCCTGCTACAGGTGCCGCCGCACACCCACGGCCCGC
  ACGCTCCCCGGACTCTGCAGCCATACGCAGGCCCGGGCATGGACAGCGGTCTGCGGCCGCGGGGGGCTCC
  GCTGGGACCGCCGCCGCCACCCGGGACCCTGGCATACGGCTCCTTCGGGTCGCCGGTCTCTTTCCAGCCC
  TTCCCCGTCTCGCAGTCGCCGGGCGCCGGTAGCACGCACCTGCAGTCTGCAGCCACACCGTCCCCGGGCC
  GCATCCCGGCGCCCCCGGCAGCCGCTGGAGGGCCCTCACCTCTGCAGCCGGCGCCCGGAGCCGCAGCCTC
  GTTGCCGCCGCCGCCGCCGCCACCCGCCCTGGGCTGCATGGACACCGAGCTCATCGACGAAGAGGCGCTG
  ACGTCGCTGGAACTCGAGCTCGGGTTGCACCGCGTACGCGAGCTGCCGGAGCTCTTCCTCGGCCAGAGCG
  AGTTCGATTGCTTCTCAGACCTGGGGTCAGCGCCGGCCGCCGGCTCGGTGAGCTGTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_019563
• Insert Size: 549 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_019563.2, NP_062509.1
• RefSeq Size: 1258 bp
• RefSeq ORF: 549 bp
• Locus ID: 56222
• UniProt ID: Q9WUL8
• Cytogenetics: 4 56.52 cM
• Gene Summary: Acts as transcriptional coactivator for TFAP2/AP-2. Enhances estrogen-dependent transactivation mediated by estrogen receptors. May function as an inhibitor of transactivation by HIF1A by disrupting HIF1A interaction with CREBBP. May be involved in regulation of gene expression during development and differentiation of blood cells, endothelial cells and mammary epithelial cells.[UniProtKB/Swiss-Prot Function]