Grasp (NM_019518) Mouse Untagged Clone

CAT#: MC210018

Grasp (untagged) - Mouse GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein (Grasp), (10ug)

USD 402.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Grasp (NM_019518) Mouse Untagged Clone
Symbol Grasp
Synonyms tamalin
Vector pCMV6-Entry
Sequence Data
>MC210018 representing NM_019518
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCTCCGCCGACTCAGGAAGCTGCAGCAGAAGGAGGAGGCGACTGCCGCGCCGGACCCCGCTGGCC
GGGCTCCCGACTCCGAAGCCGCTCGCGCCGCCCCGCTACCCTCCGGCCCTCCGGCTGCCGCCGCTCCGCC
CGGAGCCCCCGGGGAGGAGCTGTACGCAGCACTGGAGGACTATCACCCTGCCGAGCTGTACCGCGCGCTC
GCCGTGTCCGGGGGTACCCTGCCTCGCCGAAAGGGCTCAGGATTCCGTTGGAAGAATTTCACTCAGAGTC
CTGAACAGCAACGGAAGGTTCTAACTTTGGAGAAAGGGGACAACCAGACCTTTGGCTTCGAGATCCAGAC
ATATGGCCTTCACCACCGAGAGGAGCAGCGTGTAGAGATGGTGACCTTCGTCTGCCGAGTTCATGAATCC
AGCCCTGCCCAGCTGGCTGGGCTCACGCCAGGGGACACTATTGCCAGCGTCAACGGTCTCAACGTGGAAG
GCATCCGGCACCGGGAGATTGTCGATATCATCAAGGCGTCTGGCAACGTTCTCAGGCTGGAAACTCTGTA
CGGGACGTCCATTCGGAAGGCAGAACTGGAGGCGCGCCTGCAGTACCTTAAGCAAACCCTGTACGAGAAG
TGGGGAGAATACAGGTCACTTATGGTACAGGAGCAGCGGCTAGTACATGGCCTGGTGGTGAAAGACCCAA
GCATCTATGACACACTGGAGTCCGTGCGCTCCTGCCTCTACGGCGCAGGCTTGCTTCCCGGGTCGCTGCC
CTTTGGGCCTCTGCTCGCCGCGCCTGGGAGTGCCCGCGGGGGTGCGCGGCGGGCCAAAGGGGACACAGAC
GACGCCGTGTACCACACGTGCTTCTTTGGGGGCGCCGAGCCGCAGGCACTGCCACCCCCGCCACCCCCCG
CGCGCGCGTTAGGCCCGAGCTCCGCGGAGACCCCCGCGTCCGTGCTGTTTCCCGCACCTCGCTCCACGCT
CAGCCGCAGCGCCAGTGTGCGGTGCGCGGGCCCGGGCGGCGGCGGGGGCGCGCCGGGCGCACTCTGGACT
GAGGCCCGCGAGCAGGCCCTGTGTGGCGCCGGCCTACGCAAGACCAAGTACCGCAGCTTCCGCAGACGGC
TGCTCAAGTTCATCCCCGGACTCAACCGCTCCCTGGAGGAAGAGGAGAGCCAGCTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_019518
ORF Size 1179 bp
Insert Size 1179
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019518.3, NP_062391
RefSeq Size 2025
RefSeq ORF 1179
Locus ID 56149
Cytogenetics 15|15 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.