Sco1 (NM_001040026) Mouse Untagged Clone

CAT#: MC209919

Sco1 (untagged) - Mouse SCO cytochrome oxidase deficient homolog 1 (yeast) (Sco1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_001040026" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SCO1 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sco1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sco1
Synonyms 2610001C07Rik; D11Bwg1310e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209919 representing NM_001040026
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCACTTGTACGCGCCGCAGTGGTGAGGTCGCAGTGTCGCCAGCTCTGGCGTCTGTTCCCTCGCG
GCCATGGGCTCAGGGATGTGGCGGAGAGGCCGAGACCGGAGGAAGCGTGCTCCTGCCTGCGGAGCAGAGC
CTTCAGCGCTGGGCCGCCACCGCCGGGGGCCGGTCCGGAGCCCAAGGGCGGTCAAGCCGGGTCTCACCGC
CCGAAGCCTGGGCCTGTTTCTTGGAAGTCTTTAGCTCTCACCTTTGCCATTGGAGGCTCTTTATTGGCTG
GAATGAAGTACTTCAAGAAAGAAAAGATAGAAAAGCTGGAGAAACAACGGCATCGCAGCATTGGGAAGCC
TTTACTAGGGGGGCCATTTTCCCTTACAACTCACAATGGAGAGCCCAAAACCGACAAGGACTACCTGGGT
CAATGGGTATTGATTTATTTTGGCTTCACTCATTGCCCTGATATCTGTCCAGAAGAACTAGAAAAAATGA
TTGAAGTCGTGGAGGAGATAGACAGTATTCCATCCCTGCCAAATTTAACTCCACTTTTCATCACCATTGA
CCCAGAAAGGGACACCAAAGAAGCCATTGCGACTTATGTGAAAGAATTTTCTCCCAAATTGGTTGGTTTG
ACTGGCACAAAAGAAGAGATTGATGGAGTGGCCAGAGCATACAGGGTGTATTACAGCCCTGGCCCGAAGG
ATGAGGATGAAGACTACATAGTGGATCATACAATAATAATGTACTTGATTGGACCAGATGGAGAATTTCT
TGATTATTTTGGACAAAACAAGAAGAAGGCAGAAATAGCCGGCTCAATTGCTGCACACATGAGGTCACAC
ATGAAGAAGAGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001040026
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001040026.1, NP_001035115.1
RefSeq Size 4280 bp
RefSeq ORF 855 bp
Locus ID 52892
UniProt ID Q5SUC9
Cytogenetics 11 40.59 cM
Gene Summary Copper metallochaperone essential for the maturation of cytochrome c oxidase subunit II (MT-CO2/COX2). Not required for the synthesis of MT-CO2/COX2 but plays a crucial role in stabilizing MT-CO2/COX2 during its subsequent maturation. Involved in transporting copper to the Cu(A) site on MT-CO2/COX2 (By similarity). Plays an important role in the regulation of copper homeostasis by controlling the abundance and cell membrane localization of copper transporter CTR1 (PubMed:25683716, PubMed:28973536).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.