Trmt10c (NM_029092) Mouse Untagged Clone

CAT#: MC209897

Trmt10c (untagged) - Mouse RNA (guanine-9-) methyltransferase domain containing 1 (Rg9mtd1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_029092" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Trmt10c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Trmt10c
Synonyms 1300018J16Rik; D16Ertd454e; Rg9mtd1; Rnmtd1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209897 representing NM_029092
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATGTGACTGTCCGTTTCTTAAGACCTTTTGCCAGATGTCTGGTGCCATATACCTTTCATAGGAAGA
GAAGTCATTTATATTCAGGAGTTCTGCAGAGATACATGTCCTCCAAAGCACCTTCTTTGTCTTGTCATAA
TAAGGACAGTGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCATT
CAAGAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAGAGAACTAATTG
AGATGTGGAGATTGCTTGGCAAAGAAGTACCAGAACATATTACTGAAGAAGATCTCAAAACCCTTATGGA
ATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCT
AAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCA
CCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGG
TTGGAAGGGTGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACATG
AAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAGAAGAAATGTTG
ATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCATAGAGAATTAGTTAAACGTTA
TAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGAAAAGTCTCCTGTTGATTTATTTCCAAAGGAC
AGTATTATATATTTAACTGCAGATTCTCCCAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAA
TTGGATCATTTGTTGATAAAAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGC
AACAGAGTGCCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCAG
ATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTTTGTTCCCAGGA
GAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGTTAGGAAACTGAAGAAGACAAA
GACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCGCACGTGGAAAAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_029092
Insert Size 1245 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_029092.3, NP_083368.1
RefSeq Size 1846 bp
RefSeq ORF 1245 bp
Locus ID 52575
UniProt ID Q3UFY8
Cytogenetics 16 33.79 cM
Gene Summary Mitochondrial tRNA N(1)-methyltransferase involved in mitochondrial tRNA maturation. Component of mitochondrial ribonuclease P, a complex composed of TRMT10C/MRPP1, HSD17B10/MRPP2 and MRPP3, which cleaves tRNA molecules in their 5'-ends. Together with HSD17B10/MRPP2, forms a subcomplex of the mitochondrial ribonuclease P, named MRPP1-MRPP2 subcomplex, which displays functions that are independent of the ribonuclease P activity. The MRPP1-MRPP2 subcomplex catalyzes the formation of N(1)-methylguanine and N(1)-methyladenine at position 9 (m1G9 and m1A9, respectively) in tRNAs; TRMT10C/MRPP1 acting as the catalytic N(1)-methyltransferase subunit. The MRPP1-MRPP2 subcomplex also acts as a tRNA maturation platform: following 5'-end cleavage by the mitochondrial ribonuclease P complex, the MRPP1-MRPP2 subcomplex enhances the efficiency of 3'-processing catalyzed by ELAC2, retains the tRNA product after ELAC2 processing and presents the nascent tRNA to the mitochondrial CCA tRNA nucleotidyltransferase TRNT1 enzyme. In addition to tRNA N(1)-methyltransferase activity, TRMT10C/MRPP1 also acts as a mRNA N(1)-methyltransferase by mediating methylation of adenosine residues at the N(1) position of MT-ND5 mRNA.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.