Ccnc (NM_001122982) Mouse Untagged Clone

CAT#: MC209885

Ccnc (untagged) - Mouse cyclin C (Ccnc), transcript variant 2, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ccnc (NM_001122982) Mouse Untagged Clone
Symbol Ccnc
Synonyms AI451004; AU020987; CG1C
Vector pCMV6-Entry
Sequence Data
>MC209885 representing NM_001122982
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGGAACTTCTGGCAGAGCTCCCACTATTTGCAGTGGATTTTGGATAAACAAGATCTGTTGAAAG
AGCGCCAAAAGGACCTAAAGTTTCTCTCAGAAGAGGAGTATTGGAAGTTACAAATATTTTTTACAAATGT
TATCCAAGCATTAGGTGAACATCTTAAATTAAGACAACAAGTTATTGCTACTGCTACAGTCTATTTCAAG
AGATTCTATGCTAGGTATTCTCTGAAAAGTATAGATCCTGTATTAATGGCGCCTACATGTGTGTTTCTGG
CATCCAAAGTAGAGGAATTTGGTGTTGTCTCAAATACAAGATTGATTGCTGCTACTACTTCTGTATTAAA
AACTAGATTTTCATATGCTTTTCCAAAGGAATTTCCTTACAGGATGAATCATATACTAGAATGTGAATTT
TACCTCTTAGAATTAATGGACTGTTGCTTGATAGTGTATCATCCTTATAGACCTTTGCTCCAGTATGTGC
AGGACATGGGCCAGGAAGACGTGCTGCTTCCCCTTGCATGGAGGATAGTGAATGATACCTACAGGACGGA
TCTCTGTCTGCTGTACCCTCCGTTCATGATCGCTTTAGCTTGCCTACATGTAGCCTGTGTCGTACAACAG
AAAGATGCTAGACAGTGGTTTGCAGAACTTTCTGTGGATATGGAGAAGATTTTGGAAATAATCAGGGTTA
TTTTAAAACTGTATGAGCAGTGGAAGAATTTTGATGAGAGAAAAGAGATGGCAACTATTCTTAGTAAGAT
GCCGAAACCAAAACCACCTCCAAACAGAAGCTCCCTGAGTGACTCTCCACTAATGGCAGGGCCTGAAGCT
GCAAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001122982
ORF Size 849 bp
Insert Size 849
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001122982.2, NP_001116454
RefSeq Size 1476
RefSeq ORF 849
Locus ID 51813
Cytogenetics 4|4 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.