Myadm (NM_001093766) Mouse Untagged Clone

CAT#: MC209874

Myadm (untagged) - Mouse myeloid-associated differentiation marker (Myadm), transcript variant 3, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Myadm (NM_001093766) Mouse Untagged Clone
Symbol Myadm
Synonyms D7Wsu62e
Vector pCMV6-Entry
Sequence Data
>MC209874 representing NM_001093766
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGGTAACAGTAACTCGTACAACCATCACGACTACAACGTCATCCTCCACCACTGTGGGGTCCGCTC
GGGCGCTGACCCAGCCGCTGGGCCTCCTCCGCCTCCTGCAGCTAATATCCACCTGTGTGGCTTTCTCGCT
GGTGGCCAGTGTGGGTGCCTGGACAGGGCCCATGGGTAACTGGGCCATGTTCACCTGGTGTTTCTGCTTT
GCTGTTACCCTCATCATCCTGATTGTGGAGTTAGGTGGACTCCAGGCCCACTTCCCCCTGTCATGGCGAA
ACTTCCCCATCACCTTTGCCTGCTACGCGGCCCTCTTCTGCCTGTCGTCTTCCATCATCTATCCCACCAC
CTATGTGCAGTTCCTAGCTCATGGACGTACCCGGGACCATGCCATCGCTGCCACCACTTTCTCCTGCGTT
GCCTGTTTGGCGTATGCCACTGAAGTGGCCTGGACCCGTGCAAGGCCCGGTGAGATCACTGGCTATATGG
CTACCGTGCCAGGGCTGCTCAAAGTTTTTGAGACCTTCGTAGCCTGTATCATCTTTGCCTTCATCAGTGA
GCCGCTCCTGTATAATCAGAAGCCAGCCCTGGAGTGGTGTGTGGCAGTCTATGCCATCTGCTTCATACTA
GCAGGGGTGACCATCCTGCTCAACCTGGGGGATTGTACCAACGTGTTGCCCATCCCTTTCCCCACCTTCC
TCTCAGGCTTGGCCTTACTCTCTGTTCTCTTTTACGCCACTGCCATCGTCCTCTGGCCCCTCTACCAATT
TGATCAGAGATATCAGGGCCAACCCCGCCGTTCAATGGATCCAAGCTGCACTCGTAGTATTAGTTATATA
CAACCCAACACGGTGTGTTTCTGGGACCGACGACTGGCGGTGTCCATCCTGACAGGTATCAACCTGCTGG
CATATGTGTCTGATCTGGTGTACTCCACTCGTCTGGTGTTCGTCAAGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001093766
ORF Size 963 bp
Insert Size 963
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001093766.1, NP_001087235
RefSeq Size 2904
RefSeq ORF 963
Locus ID 50918
Cytogenetics 7 A1|7 1.92 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.