Lats2 (NM_153382) Mouse Untagged Clone
CAT#: MC209854
Lats2 (untagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B, (10ug)
"NM_153382" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Lats2 |
Synonyms | 4932411G09Rik; AV277261; AW228608 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209854 representing NM_153382
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCCAAAGACTTTTCCTGCCACAACTTACTCTGGAAATAGCCGGCAGCGATTGCAAGAGATTCGAG AGGGGCTGAAGCAGCCATCCAAGGCTTCCACCCAGGGGCTGCTGGTGGGACCAAACAGTGACACTTCCCT GGATGCCAAAGTCCTGGGGAGCAAAGATGCCTCCAGGCAGCAGCAAATGAGAGCCACCCCGAAGTTTGGA CCTTATCAAAAAGCTCTCAGGGAAATCCGATATTCCCTCCTGCCTTTTGCCAACGAGTCAGGCACTTCGG CAGCTGCAGAGGTGAACCGGCAGATGCTTCAGGAGTTGGTGAATGCGGGATGTGACCAGATGCATATTCC TGGTGCGTGTCTGTTTCTGGAGATGCTCCTGTCTGTCCCTCCCATCTCCCAAACAGCAGCACCTGGATTA CAGGCACACAGGCTGCTACAGCTTTGCAGTGTGTGCGAATTCAAGCTCGGACCCTCACACTTGTACCTGA AGCACGGAGCCAGCCGTCTTCTCAGCCCCTTATGTCCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_153382 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153382.1, NP_700431.1 |
RefSeq Size | 913 bp |
RefSeq ORF | 531 bp |
Locus ID | 50523 |
Cytogenetics | 14 C3 |
Gene Summary | Negative regulator of YAP1 in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. Acts as a tumor suppressor which plays a critical role in centrosome duplication, maintenance of mitotic fidelity and genomic stability. Negatively regulates G1/S transition by down-regulating cyclin E/CDK2 kinase activity. Negative regulator of the androgen receptor. Phosphorylates SNAI1 in the nucleus leading to its nuclear retention and stabilization, which enhances its epithelial-mesenchymal transition and tumor cell invasion/migration activities. This tumor-promoting activity is independent of its effects upon YAP1 or WWTR1/TAZ (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (B) lacks the first exon, most of the 3' coding region and uses a different terminal exon compared to variant A. The resulting protein (isoform 2, also called LATS2B) is much shorter and has a distinct C-terminus when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226238 | Lats2 (tGFP-tagged) - Mouse large tumor suppressor 2 (Lats2) transcript variant B, (10ug) |
USD 500.00 |
|
MR226238 | Lats2 (Myc-DDK-tagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B |
USD 300.00 |
|
MR226238L3 | Lenti ORF clone of Lats2 (Myc-DDK-tagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B |
USD 600.00 |
|
MR226238L4 | Lenti ORF clone of Lats2 (mGFP-tagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review