Hacd1 (NM_001012396) Mouse Untagged Clone
CAT#: MC209848
Ptpla (untagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a (Ptpla), transcript variant 2, (10ug)
"NM_001012396" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hacd1 |
Synonyms | Ptpla |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209848 representing NM_001012396
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTCCAGTGAGGAGGACGGCACCAACGGCGCCTCCGAGGCCAGCGACGAGAAGGAAGCCGCCGGCA AGCGGAGACGCCTAGGCTTACTGGCCACCGCCTGGCTCACCTTCTACAATATCGCCATGACGGCCGGGTG GTTGGTTCTTGCTATTGCTATGGTACGCTTTTATATGGAAAAAGGAACACACAGAGGTTTATATAAAAGC ATTCAGAAGACACTTAAGTTTTTCCAAACATTTGCTTTGCTTGAGGTAGTCCATTGTCTGATCGGAATTG TACCCACTTCTGTGCTTGTGACTGGGGTCCAAGTGAGCTCAAGAATCTTCATGGTGTGGCTCATTACTCA CAGTATAAAACCCATACAATTTGTTTATCATCTTATATCCCGTTGGAGTTGCTGGGGAACTTCTCACAAT ATACGCCGCCTTGCCTTACGTAAAGAAGTCAGGAATGTTCTCAGTACGGCTTCCCAACAAGTACAATGTT TCTTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001012396 |
Insert Size | 498 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001012396.2, NP_001012396.2 |
RefSeq Size | 893 bp |
RefSeq ORF | 498 bp |
Locus ID | 30963 |
Cytogenetics | 2 A1- A2 |
Gene Summary | Catalyzes the third of the four reactions of the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates in the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate exon, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225242 | Ptpla (tGFP-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine) member a (Ptpla) transcript variant 2, (10ug) |
USD 365.00 |
|
MR225242 | Ptpla (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a (Ptpla), transcript variant 2 |
USD 165.00 |
|
MR225242L3 | Lenti ORF clone of Ptpla (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a (Ptpla), transcript variant 2 |
USD 465.00 |
|
MR225242L4 | Lenti ORF clone of Ptpla (mGFP-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a (Ptpla), transcript variant 2 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review