Zfp385a (NM_013866) Mouse Untagged Clone

CAT#: MC209814

Zfp385a (untagged) - Mouse zinc finger protein 385A (Zfp385a), (10ug)


  "NM_013866" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zfp385a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp385a
Synonyms Hzf; Zfp385; Znf385a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209814 representing NM_013866
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCTCGGCAGCCTGAGCCGGGCAGGGCCCCTCCCTCTGCTCCGGCAGCCCCCCATCATGCAGCCAC
CGATGGACCTCAAGCAGATCCTGCCCTTCCCACTAGAGCCAGCCCCAACCCTGGGCCTCTTCAGCAACTA
CAGCACAATGGACCCTGTACAGAAAGCTGTGCTCTCCCACACTTTTGGAGGACCCTTGCTCAAGACCAAG
CGGCCAGTCATTTCCTGTAATGTCTGTCAGATCCGCTTCAATTCTCAGAGCCAGGCTGAGGCGCACTACA
AGGGTAATCGCCATGCCCGAAGAGTCAAAGGCATCGAAGCTGCCAAAACCCGAGGCAGGGAGCCTAGTGT
CCGGGAATCAGGAGATCCAGCTCCAGCAGGCAGCATCCCTCCGAGTGGGGATGGTGTAGCCCCTCGTCCA
GTTTCCATGGAGAATGGCCTGGGTCCAGCTCCAGGATCCCCAGAGAAACAGCCTGGCTCCCCATCCCCTC
CCAGTGTTCCAGAGTCGGGACAGGGTGTAACCAAGGGTGAAGGGGGAACTTCAGTCCCAGCTTCCCTGCC
TGGGGGTAGCAAGGAAGAGGAGGAGAAGGCTAAGCGTCTGCTCTACTGTGCACTGTGCAAGGTGGCTGTG
AACTCCCTGTCCCAGCTTGAGGCACATAACAAAGGTACTAAGCACAAGACAATTTTGGAGGCCCGAAGTG
GGCTGGGACCCATCAAAGCTTACCCTCGGTTGGGGCCTCCCACTCCTGGGGAACCAGAGGCTCCTGCCCA
GGACCGAACCTTCCACTGTGAGATCTGCAATGTCAAGGTCAATTCGGAGGTCCAGCTGAAACAGCACATC
TCCAGCAGGAGGCACCGAGATGGCGTGGCTGGGAAGCCCAACCCTCTACTGAGCCGGCACAAGAAGCCTA
GGGGCGCTGCAGAGCTGGCGGGCACGCTGACTTTCTCAAAGGAGCTGCCCAAGTCCCTGGCCGGTGGCCT
GCTCCCCAGCCCCCTAGCGGTGGCTGCGGTGATGGCCGCTGCAGCAGGATCTCCGCTGTCCCTGCGTCCA
GCTCCAGCTGCACCTCTTCTGCAGGGACCACCGATCACACACCCTCTACTCCACCCTGCCCCAGGACCCA
TCCGAACTGCGCACGGACCCATCCTCTTCTCCCCCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013866
Insert Size 1161 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013866.2, NP_038894.2
RefSeq Size 2320 bp
RefSeq ORF 1161 bp
Locus ID 29813
UniProt ID Q8VD12
Cytogenetics 15 F3
Gene Summary RNA-binding protein that affects the localization and the translation of a subset of mRNA. May play a role in adipogenesis through binding to the 3' UTR of CEBPA mRNA and regulation of its translation. Targets ITPR1 mRNA to dendrites in Purkinje cells, and may regulate its activity-dependent translation. With ELAVL1, binds the 3' UTR of p53/TP53 mRNAs to control their nuclear export induced by CDKN2A. Hence, may regulate p53/TP53 expression and mediate in part the CDKN2A anti-proliferative activity. May also bind CCNB1 mRNA. Alternatively, may also regulate p53/TP53 activity through direct protein-protein interaction. Interacts with p53/TP53 and promotes cell-cycle arrest over apoptosis enhancing preferentially the DNA binding and transactivation of p53/TP53 on cell-cycle arrest target genes over proapoptotic target genes. May also regulate the ubiquitination and stability of CDKN1A promoting DNA damage-induced cell cycle arrest. Also plays a role in megakaryocytes differentiation.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.