Slc14a2 (NM_001110274) Mouse Untagged Clone

CAT#: MC209795

Slc14a2 (untagged) - Mouse solute carrier family 14 (urea transporter), member 2 (Slc14a2), transcript variant 4, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Slc14a2
• Synonyms: UT-A1; UT-A3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209795 representing NM_001110274
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTTGTCAACAACCCCATTAGTGGGCTCATCATCTTCATAGGGCTCCTAATCCAGAATCCCTGGTGGA
  CGATTGCTGGGACACTGGGGACAGTGGCTTCAACCTTGGCTGCCCTTGCCTTAAGCCAGGACAGGTCAGC
  CATCGCCTCCGGACTCCATGGCTACAACGGGATGCTGGTGGGACTGCTGATGGCTGTCTTCTCGGAGAAG
  TTAGACTACTACTGGTGGCTTCTGTTTCCTGTGACCTTCACATCCATGGCCTGCCCCATTATTTCTAGTG
  CCTTGAGTACCATCTTCGCCAAGTGGGACCTGCCCGTCTTCACACTGCCCTTCAACATTGCCTTAACACT
  GTACCTGGCAGCTACGGGCCACTACAACCTTTTCTTCCCCACCACGCTCATCAAGCCTGCGTCTGCAGCT
  CCCAATATCACCTGGACAGAGATTGAAATGCCTTTGCTGTTACAAACCATCCCTGTTGGGGTCGGCCAGG
  TCTACGGCTGTGACAACCCCTGGACAGGTGGCATGATCCTGGTGGCTCTGTTTATCTCCTCCCCACTCAT
  CTGCTTACATGCAGCCATAGGGTCAATCGTGGGGCTGCTAGCAGCATTGACTGTGGCCACTCCCTTTGAG
  ACGATCTACCTGGGCCTTTGGAGCTACAACTGTGTCCTCTCCTGCATTGCCATTGGCGGCATGTTCTACG
  CACTCACCTGGCAGACACACCTGCTGGCACTTGTCTGTGCCCTGTTCTGTGCATACATGGGAGCTGCCCT
  CTCCAATACAATGGCAGTGGTTGGCGTGCCCTCAGGCACCTGGGCCTTCTGTCTCTCCACCCTCACCTTC
  CTCCTCCTCACAAGCAACAACACTGGCATCTACAAGCTCCCACTCAGCAAAGTCACCTACCCGGAGGCCA
  ACCGCATCTACTTCCTGACAGTGAGACGCAGTGAAGAGGAGAAGTCCCCCAATGGTGACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110274
• Insert Size: 972 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001110274.1, NP_001103744.1
• RefSeq Size: 1428 bp
• RefSeq ORF: 972 bp
• Locus ID: 27411
• UniProt ID: Q8R4T9
• Cytogenetics: 18 E3
• Gene Summary: Specialized low-affinity vasopressin-regulated urea transporter. Mediates rapid transepithelial urea transport across the inner medullary collecting duct and plays a major role in the urinary concentrating mechanism. Vasopressin regulates urea transport by increasing isoform A1 accumulation in the plasma membrane and/or phosphorylation of isoform A1 (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4), also known as UT-A5, contains a distinct 5' UTR, 3' CDS and 3' UTR, and lacks multiple 5' and 3' coding exons, compared to variant 1. The resulting isoform (d) is substantially shorter at the N- and C-termini, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.