Pla2g2f (NM_012045) Mouse Untagged Clone

CAT#: MC209755

Pla2g2f (untagged) - Mouse phospholipase A2, group IIF (Pla2g2f), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pla2g2f
• Synonyms: GIIFsPLA2; sPLA2-IIF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209755 representing NM_012045
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCAGATGGGGCACAGGCCAACCCCAAAGGGTTCAGGAAGAAGGCGCTGGTTAAACACTCCACTGGAC
  GGAAGAGCCCAAGCCTCAGGGCCTCTCCCTCTAAAACCTCCAGGTCCAGCCTGGGTATGAAGAAATTCTT
  TGCCATCGCAGTCCTGGCCGGCAGTGTGGTAACCACGGCCCACAGCAGCCTGCTGAACCTGAAGTCCATG
  GTGGAGGCCATCACACACAGAAACTCCATCCTGTCCTTTGTGGGCTACGGCTGCTACTGCGGGCTGGGGG
  GACGCGGCCATCCCATGGATGAGGTAGACTGGTGCTGCCATGCCCACGACTGTTGCTATGAGAAGCTCTT
  TGAGCAGGGCTGCCGCCCCTACGTGGACCACTATGACCACAGGATCGAGAATGGCACCATGATTGTCTGC
  ACTGAGCTCAATGAGACGGAGTGTGACAAGCAGACATGCGAGTGTGACAAGAGCCTGACTCTGTGCCTCA
  AGGATCACCCATACAGGAACAAGTACCGAGGCTACTTCAACGTCTACTGCCAGGGCCCCACACCCAACTG
  CAGCATCTATGACCCGTACCCAGAGGAAGTCACCTGTGGGCATGGCCTCCCTGCGACCCCTGTCTCAACC
  TAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_012045
• Insert Size: 633 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_012045.4, NP_036175.2
• RefSeq Size: 2437 bp
• RefSeq ORF: 633 bp
• Locus ID: 26971
• UniProt ID: Q9QZT4
• Cytogenetics: 4 D3
• Gene Summary: May play a role in lipid mediator production in inflammatory conditions, by providing arachidonic acid to downstream cyclooxygenases and lipoxygenases. Phospholipase A2, which catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides (PubMed:10531313). Hydrolyzes phosphatidylethanolamine more efficiently than phosphatidylcholine, with only a modest preference for arachidonic acid versus linoelic acid at the sn-2 position. Comparable activity toward 1-palmitoyl-2-oleoyl-phosphatidylserine vesicles to that toward 1-palmitoyl-2-oleoyl-phosphatidylglycerol (PubMed:11877435). Prefers phosphatidylglycerol compared to phosphatidylcholine (PubMed:10531313).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes a longer protein (isoform 1), which lacks a signal peptide. With the available data, it is not clear which start codon is most likely used.