Macroh2a1 (NM_001159514) Mouse Untagged Clone

SKU
MC209751
H2afy (untagged) - Mouse H2A histone family, member Y (H2afy), transcript variant 3, (10ug)
  $503.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Macroh2a1
Synonyms H2af; H2AF12; H2AF12M; H2afy; MACROH2; mH2a; mH2a1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209751 representing NM_001159514
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGAGCCGCGGCGGGAAGAAGAAATCCACCAAGACCTCCCGGTCAGCCAAGGCCGGAGTCATCTTCC
CTGTGGGACGCATGCTTCGGTACATCAAGAAAGGCCACCCTAAGTATAGGATCGGAGTGGGGGCACCTGT
GTACATGGCTGCTGTCCTGGAGTACCTGACTGCTGAGATCCTGGAGCTGGCTGGCAATGCAGCAAGAGAC
AACAAGAAGGGACGGGTCACACCCCGGCACATCCTGTTAGCTGTGGCCAATGATGAAGAGCTAAACCAGC
TGCTAAAGGGTGTCACCATAGCCAGCGGGGGCGTGTTGCCGAATATCCATCCTGAGTTGCTAGCGAAGAA
GCGAGGATCCAAGGGAAAATTGGAAGCCATCATCACGCCTCCGCCGGCCAAAAAGGCCAAGTCTCCATCC
CAGAAGAAGCCAGTGGCTAAGAAGACAGGAGGCAAGAAAGGGGCCCGGAAGTCTAAGAAGAAGCAGGGAG
AAGTGAGCAAGGCGGCCAGCGCAGACAGTACGACGGAGGGCACGCCTACAGACGGCTTCACTGTCCTCTC
CACCAAGAGCCTCTTCCTCGGCCAGAAGTTGCAAGTTGTTCAGGCTGACATTGCCTCGATCGACAGTGAT
GCTGTCGTTCACCCGACAAACACTGACTTCTACACCGGTGGTGAAGTAGGAAACACACTGGAGAAGAAGG
GCGGCAAGGAGTTTGTAGAAGCTGTTCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAGGTAGCTGGAGC
TGCTATTAGTGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCTGTCTGGGGTGCA
GACAAATGTGAAGAACTTCTAGAAAAGACGGTGAAAAACTGCTTGGCTCTAGCTGATGACAGAAAGCTGA
AATCCATCGCCTTCCCATCCATTGGCAGCGGCAGGAACGGGTTCCCGAAGCAGACAGCGGCCCAGCTCAT
TCTGAAGGCCATCTCCAGCTACTTTGTCTCCACGATGTCCTCCTCCATCAAAACTGTGTACTTCATGCTT
TTTGACAGTGAGAGCATAGGTATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001159514
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001159514.1, NP_001152986.1
RefSeq Size 1969 bp
RefSeq ORF 1110 bp
Locus ID 26914
UniProt ID Q9QZQ8
Cytogenetics 13 B1
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Nov 2015
Transcript Variant: This variant (3) uses an alternate exon in the central coding region, compared to variant 1. The resulting isoform (3) differs in one internal segment, compared to isoform 1.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001159514" in other vectors (4)
SKU Description Size Price
MG221870 H2afy (tGFP-tagged) - Mouse H2A histone family member Y (H2afy) transcript variant 3, (10ug) 10 ug
$703.00
MR221870 H2afy (Myc-DDK-tagged) - Mouse H2A histone family, member Y (H2afy), transcript variant 3 10 ug
$289.00 $503.00
MR221870L3 Lenti ORF clone of H2afy (Myc-DDK-tagged) - Mouse H2A histone family, member Y (H2afy), transcript variant 3 10 ug
$803.00
MR221870L4 Lenti ORF clone of H2afy (mGFP-tagged) - Mouse H2A histone family, member Y (H2afy), transcript variant 3 10 ug
$803.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products