Krtap15 (NM_013713) Mouse Untagged Clone

CAT#: MC209739

Krtap15 (untagged) - Mouse keratin associated protein 15 (Krtap15), (10ug)


  "NM_013713" in other vectors (4)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Krtap15"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Krtap15
Synonyms Krtap15-1; Pmg-2; Pmg2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209739 representing NM_013713
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTTACACTTGCAACTCTGGAAACTACTCCTCACAGTCTTTTGGAGGTTTCTTGAGGCAGCCAGTCT
CTACCTACAACTCCTTCTACCCCACCAGCAATGTAGTCTATTCTCCAAAGAACTTCCAGCTGGGATCCTC
TTTCTACAATGGACAGCAGGAGACCTTCAGTGAGCCACTTGAAGGCCACTTGCCCTGTGTGGGGTCTGCA
TCCTTCCACACATCCTGTTTCCGGCCTAAGCAATACTTCTCCAGCCCCTGCCAGGGAGGCTTTACCGGAT
CTTTTGGATATGGCAATACTGGCTTTGGAGCTTTTGGGTTTGGAAGCTCTGGCATTCGCTCTCAGGGCTG
TGGATCCAACTTCTACCGTCCAGGATACTTTTCTTCTAAGAGTATCCAGTCATCTTACTACCAGCCAGGC
TACAGCTCTGGCTTTTGCGGGTCAAATTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013713
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013713.1, NP_038741.1
RefSeq Size 836 bp
RefSeq ORF 453 bp
Locus ID 26560
UniProt ID Q9QZU5
Cytogenetics 16 C3.3
Gene Summary In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.