Zfp41 (NM_011759) Mouse Untagged Clone

CAT#: MC209664

Zfp41 (untagged) - Mouse zinc finger protein 41 (Zfp41), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Zfp41
• Synonyms: CTfin92; Zfp-41
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209664 representing NM_011759
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAAAGCCTGCAACTAGGAAAAAGAAGAGTCAGGCCCCAAAGGAGGAGGCAGGTGCGCAAAAGGCCA
  CTGTCAAGGGAGAGAAAACATCAAAGGGGAAAAAGGCAACCAAGAAGCCAAGAAAGCCCCGCAGACCCCG
  AAAAGAACCTGTCCTGAGCCCCGAGGACGAAGCACATATCTTTGATGCCTTCGATGCCTCGTTTAAAGAT
  GACTTTGAGGGTGTCCCCGTGTTTGTCCCTTTTCAGAGGAAGAAGCCCTATGAGTGTGGTGAATGTGGAC
  GGATCTTTAAACACAAGACAGATCACATTCGCCACCAGAGAGTTCACACTGGAGAGAAGCCCTTTAAGTG
  TGACCAGTGTGGGAAGACCTTCAGGCACAGCTCAGATGTCACCAAACATCAAAGAATTCACACCGGTGAG
  AAGCCCTTTAAATGTGGGGAGTGTGGAAAAGCCTTCAACTGTGGTTCTAACCTTCTAAAACACCAGAAAA
  CGCACACTGGAGAGAAACCTTATGGCTGTGAGGAGTGTGGAAAATCCTTCGCCTACAGCTCCTGCCTCAT
  CCGGCATCGGAAGCGTCATCCGAGGAAGAAGCACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011759
• Insert Size: 597 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_011759.3, NP_035889.1
• RefSeq Size: 3761 bp
• RefSeq ORF: 597 bp
• Locus ID: 22701
• UniProt ID: Q02526
• Cytogenetics: 15 D3
• Gene Summary: A putative DNA-binding regulatory protein associated with meiosis in spermatogenesis.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. CCDS Note: This CCDS ID represents the protein described in PMID: 1397691. This protein is encoded by two alternate splice variants supported by BC053927.1 and AK030420.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 1397691. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.