Vegfa (NM_001025250) Mouse Untagged Clone

CAT#: MC209637

Vegfa (untagged) - Mouse vascular endothelial growth factor A (Vegfa), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vegfa
• Synonyms: V; Veg; Vegf; VEGF12; VEGF16; VEGF18; Vpf
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NM_001025250.3
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  CTGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGCGCCCACCTCCTCGCCGGCGGGCTGCCGACGG
  TGGACGCGGCGGCGAGCCGCGAGGAACCGAAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCGGGGCTCG
  CGGGATTGCACGGAAACTTTTCGTCCAACTTCTGGGCTCTTCTCGCTCCGTAGTAGCCGTGGTCTGCGCC
  GCAGGAGACAAACCGATCGGAGCTGGGAGAAGTGCTAGCTCGGGCCTGGAGAAGCCGGGGCCCGAGAAGA
  GAGGGGAGGAAGAGAAGGAAGAGGAGAGGGGGCCGCAGTGGGCGCTCGGCTCTCAGGAGCCGAGCTCATG
  GACGGGTGAGGCGGCCGTGTGCGCAGACAGTGCTCCAGCCGCGCGCGCGCCCCAGGCCCCGGCCCGGGCC
  TCGGTTCCAGAAGGGAGAGGAGCCCGCCAAGGCGCGCAAGAGAGCGGGCTGCCTCGCAGTCCGAGCCGGA
  GAGGGAGCGCGAGCCGCGCCGGCCCCGGACGGGCCTCCGAAACCATGAACTTTCTGCTCTCTTGGGTGCA
  CTGGACCCTGGCTTTACTGCTGTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAAGGA
  GAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGATTGAGA
  CCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTCCTGTGTGCCGCT
  GATGCGCTGTGCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCAGAGAGCAACATCACC
  ATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGCA
  GATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAAAAAATCAGTTCGAGGAAAGGGAAAGGG
  TCAAAAACGAAAGCGCAAGAAATCCCGGTTTAAATCCTGGAGCGTTCACTGTGAGCCTTGTTCAGAGCGG
  AGAAAGCATTTGTTTGTCCAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCA
  AGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCAAGGCGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001025250
• Insert Size: 1179 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001025250.3, NP_001020421.2
• RefSeq Size: 3547 bp
• RefSeq ORF: 1179 bp
• Locus ID: 22339
• UniProt ID: Q00731
• Cytogenetics: 17 22.79 cM
• Gene Summary: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.[provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (1) represents the longest transcript. This variant can initiate translation from a non-AUG (CUG) site and also from a downstream, in-frame AUG site. The isoform (1) represented in this RefSeq is translated from the CUG start codon and is the longest isoform. Sequence Note: A non-AUG (CUG) translation initiation codon is selected for this RefSeq based on conservation with the human ortholog, for which the use of the CUG start codon has been demonstrated in the literature, including PMIDs:11352659, 11563986 and 11731620.