Ugcg (NM_011673) Mouse Untagged Clone

CAT#: MC209618

Ugcg (untagged) - Mouse UDP-glucose ceramide glucosyltransferase (Ugcg), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ugcg
• Synonyms: AU043821; C80537; Epcs21; GlcT-1; Ugcgl
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209618 representing NM_011673
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCTGCTGGACCTGGCCCAGGAGGGAATGGCCTTGTTCGGCTTCGTGCTCTTCGTGGTGCTGTGGC
  TGATGCATTTCATGTCCATCATCTACACCCGGTTACACCTCAACAAGAAGGCAACAGACAAACAGCCGTA
  TAGCAAGCTCCCTGGTGTCTCTCTTCTGAAGCCACTGAAGGGGGTGGATCCTAACCTAATCAACAACTTG
  GAGACATTCTTTGAACTGGATTATCCCAAATATGAAGTACTCCTTTGTGTACAAGATCATGATGATCCAG
  CCATTGATGTATGTAAGAAATTGCTTGGAAAATACCCAAATGTCGATGCTAGATTATTTATAGGTGGCAA
  AAAGGTTGGCATTAACCCTAAAATTAATAATTTGATGCCAGCATATGAAGTTGCAAAATATGATCTCATA
  TGGATTTGTGATAGCGGAATAAGAGTCATCCCAGACACATTAACTGACATGGTGAATCAGATGACAGAGA
  AAGTGGGGTTGGTCCACGGGCTGCCGTATGTAGCCGACAGACAAGGCTTTGCTGCCACCTTAGAGCAGGT
  ATATTTTGGAACTTCACACCCAAGATCCTATATCTCTGCCAATGTAACTGGCTTCAAATGTGTGACGGGG
  ATGTCTTGTTTGATGAGGAAGGATGTGCTAGATCAGGCAGGAGGGCTCATAGCCTTTGCTCAGTACATTG
  CTGAAGATTACTTTATGGCCAAAGCAATAGCCGACCGAGGTTGGAGGTTTTCAATGTCTACTCAAGTTGC
  CATGCAAAACTCTGGTTCGTACTCAATTTCTCAGTTTCAATCCAGAATGATCAGGTGGACCAAATTGAGA
  ATTAACATGCTTCCTGCTACAATAATTTGTGAGCCAATTTCAGAATGCTTTGTTGCCAGTTTAATTATTG
  GGTGGGCAGCCCACCATGTATTCAGATGGGATATCATGGTCTTCTTCATGTGCCACTGCCTGGCATGGTT
  TATATTTGACTACATTCAACTCAGGGGTGTCCAGGGTGGCACACTGTGTTTTTCAAAACTTGATTATGCT
  GTGGCCTGGTTCATCCGTGAATCCATGACAATCTACATTTTCCTGTCGGCATTATGGGACCCGACTATAA
  GCTGGAGAACTGGTCGCTACAGGTTACGCTGTGGGGGGACAGCAGAGGAGATCCTGGATGTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011673
• Insert Size: 1185 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC050828, AAH50828
• RefSeq Size: 3719 bp
• RefSeq ORF: 1185 bp
• Locus ID: 22234
• UniProt ID: O88693
• Cytogenetics: 4 B3
• Gene Summary: Catalyzes at the cytosolic surface of the Golgi, the initial step of the glucosylceramide-based glycosphingolipid/GSL synthetic pathway, the transfer of glucose from UDP-glucose to ceramide to produce glucosylceramide/GlcCer (PubMed:10430909, PubMed:16109770, PubMed:28373486). Glucosylceramide is the core component of glycosphingolipids/GSLs, amphipathic molecules consisting of a ceramide lipid moiety embedded in the outer leaflet of the membrane, linked to one of hundreds of different externally oriented oligosaccharide structures (PubMed:10430909). Glycosphingolipids are essential components of membrane microdomains that mediate membrane trafficking and signal transduction (PubMed:10430909). They are implicated in many fundamental cellular processes, including growth, differentiation, migration, morphogenesis, cell-to-cell and cell-to-matrix interactions (PubMed:10430909). They are required for instance in the proper development and functioning of the nervous system (PubMed:16109770). As an example of their role in signal transduction, they regulate the leptin receptor/LEPR in the leptin-mediated signaling pathway (PubMed:23554574). They also play an important role in the establishment of the skin barrier regulating keratinocyte differentiation and the proper assembly of the cornified envelope (PubMed:17145749, PubMed:23748427). The biosynthesis of GSLs is also required for the proper intestinal endocytic uptake of nutritional lipids (PubMed:22851168).[UniProtKB/Swiss-Prot Function]