Tpm1 (NM_024427) Mouse Untagged Clone

CAT#: MC209571

Tpm1 (untagged) - Mouse tropomyosin 1, alpha (Tpm1), transcript variant 3, (10ug)


  "NM_024427" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tpm1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tpm1
Synonyms AA986836; AI854628; alpha-TM; TM2; Tm3; Tmpa; Tpm-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209571 representing NM_024427
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACGCCTTGGATCGAGCTGAGC
AAGCGGAGGCTGATAAGAAGGCGGCGGAAGACCGGAGCAAGCAGCTGGAAGATGAGCTGGTGTCACTGCA
AAAGAAACTCAAGGGCACTGAAGATGAACTGGACAAATACTCCGAGGCTCTCAAAGATGCCCAGGAGAAA
CTGGAGCTGGCGGAGAAAAAGGCCACAGATGCTGAAGCTGACGTAGCTTCTCTGAACAGACGCATCCAGC
TGGTTGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTGCAGAAGCTGGAGGAGGCCGA
GAAGGCTGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAAAGCCGAGCCCAAAAAGATGAAGAAAAG
ATGGAGATTCAGGAGATCCAGCTGAAAGAGGCCAAGCACATTGCTGAAGATGCTGACCGGAAGTATGAAG
AGGTGGCCCGTAAGCTGGTCATCATCGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGA
AGGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACGGTGACGAACAACTTGAAGTCACTGGAGGCTCAG
GCTGAGAAGTACTCTCAGAAGGAAGACAAATATGAAGAGGAGATCAAGGTTCTCTCTGACAAGCTGAAGG
AGGCTGAAACTCGGGCTGAGTTTGCAGAGAGATCAGTAACCAAATTGGAGAAAAGCATTGATGACTTAGA
AGAGAAAGTGGCCCATGCCAAAGAAGAAAACCTTAGTATGCACCAGATGCTGGATCAGACTTTACTGGAG
CTAAACAACATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024427
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024427.4, NP_077745.2
RefSeq Size 1702 bp
RefSeq ORF 855 bp
Locus ID 22003
UniProt ID P58771
Cytogenetics 9 36.27 cM
Gene Summary Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (Tpm1.6, also known as variant 3) represents one of the longest transcripts and encodes one of the longest isoforms (Tpm1.6cy). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.