Dynlt1b (NM_009342) Mouse Untagged Clone

CAT#: MC209505

Dynlt1b (untagged) - Mouse dynein light chain Tctex-type 1D (Dynlt1b), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dynlt1b (NM_009342) Mouse Untagged Clone
Symbol Dynlt1b
Synonyms AGS2; Dynlt1; Tctex-1; Tctex1
Vector pCMV6-Entry
Sequence Data
>MC209505 representing NM_009342
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGACTTCCAGGCCTCAGAGGAGACTGCATTTGTTGTTGATGAAGTGAGCAGCATTGTAAAGGAGG
CTATAGAAAGCGCCATCGGTGGTAATGCCTACCAGCACAGCAAAGTCAACCAGTGGACCACTAATGTCCT
AGAACAGACTTTGAGCCAACTCACCAAACTGGGGAGACCATTTAAATACATTGTGACCTGTGTGATCATG
CAGAAGAACGGTGCTGGGTTACACTCCGCAAGTTCCTGCTTCTGGGACAGCTCCACAGACGGAAGCTGCA
CAGTCCGATGGGAGAACAAGACCATGTACTGCATCGTCAGTACCTTCGGACTGTCCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_009342
ORF Size 342 bp
Insert Size 342
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009342.2, NP_033368
RefSeq Size 791
RefSeq ORF 342
Locus ID 21648
Cytogenetics 17 A1|17 3.97 cM
Gene Summary Plays a role in neuronal morphogenesis; the function is independent of cytoplasmic dynein and seems to be coupled to regulation of the actin cytoskeleton by enhancing Rac1 activity. The function in neurogenesis may be regulated by association with a G-protein beta-gamma dimer. May function as a receptor-independent activator of heterotrimeric G-protein signaling; the activation appears to be independent of a nucleotide exchange. Plays a role in regulating neurogenesis; inhibits the genesis of neurons from precursor cells during cortical development presumably by antagonizing ARHGEF2. Involved in the regulation of mitotic spindle orientation. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.