Stx1a (NM_016801) Mouse Untagged Clone

CAT#: MC209479

Stx1a (untagged) - Mouse syntaxin 1A (brain) (Stx1a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Stx1a
• Synonyms: HPC-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209479 representing NM_016801
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGACAGCGATGACGACGACGATGTCACTGTCACTG
  TGGACCGAGACCGCTTCATGGATGAATTCTTTGAACAGGTGGAAGAGATCCGGGGCTTTATTGACAAGAT
  TGCCGAAAACGTGGAGGAGGTGAAGCGGAAACACAGCGCCATCCTGGCCTCCCCGAACCCCGATGAGAAG
  ACAAAGGAGGAACTGGAGGAGCTCATGTCGGACATTAAGAAGACAGCGAACAAAGTTCGCTCCAAGCTAA
  AGAGCATTGAGCAGAGCATCGAGCAGGAGGAAGGTCTGAACCGCTCATCAGCCGACCTGAGGATCCGGAA
  GACGCAGCACTCCACGCTGTCCCGAAAGTTTGTGGAGGTCATGTCCGAGTACAACGCCACTCAGTCAGAC
  TACCGAGAACGCTGCAAAGGGCGCATCCAGAGGCAGCTGGAGATCACCGGCCGGACCACGACCAGTGAGG
  AATTGGAAGACATGCTGGAGAGTGGGAACCCTGCCATCTTTGCCTCTGGGATCATCATGGACTCCAGCAT
  CTCGAAGCAGGCCCTCAGTGAGATCGAGACCAGACACAGTGAGATCATCAAGCTGGAGACCAGCATCCGG
  GAGCTGCACGACATGTTCATGGACATGGCCATGCTGGTGGAGAGCCAGGGGGAGATGATTGACAGGATCG
  AGTACAATGTGGAGCACGCCGTGGACTACGTGGAGAGGGCCGTGTCAGACACCAAGAAGGCCGTCAAGTA
  CCAGAGCAAGGCGCGCAGGAAGAAGATCATGATCATCATTTGCTGTGTGATTCTGGGCATCATCATCGCC
  TCCACCATCGGGGGCATCTTTGGATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_016801
• Insert Size: 867 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_016801.4, NP_058081.2
• RefSeq Size: 2206 bp
• RefSeq ORF: 867 bp
• Locus ID: 20907
• UniProt ID: O35526
• Cytogenetics: 5 G2
• Gene Summary: Plays an essential role in hormone and neurotransmitter calcium-dependent exocytosis and endocytosis (PubMed:17502420, PubMed:28596237, PubMed:28031464). Part of the SNARE (Soluble NSF Attachment Receptor) complex composed of SNAP25, STX1A and VAMP2 which mediates the fusion of synaptic vesicles with the presynaptic plasma membrane. STX1A and SNAP25 are localized on the plasma membrane while VAMP2 resides in synaptic vesicles. The pairing of the three SNAREs from the N-terminal SNARE motifs to the C-terminal anchors leads to the formation of the SNARE complex, which brings membranes into close proximity and results in final fusion. Participates in the calcium-dependent regulation of acrosomal exocytosis in sperm (PubMed:12101244). Plays also an important role in the exocytosis of hormones such as insulin or glucagon-like peptide 1 (GLP-1) (PubMed:17502420, PubMed:28596237, PubMed:28031464).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longer isoform (1).