Ccl5 (NM_013653) Mouse Untagged Clone

CAT#: MC209366

Ccl5 (untagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ccl5 (NM_013653) Mouse Untagged Clone
Symbol Ccl5
Synonyms MuRantes; RANTES; Scya5; SISd; TCP228
Vector pCMV6-Entry
Sequence Data
>MC209366 representing NM_013653
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGATCTCTGCAGCTGCCCTCACCATCATCCTCACTGCAGCCGCCCTCTGCACCCCCGCACCTGCCT
CACCATATGGCTCGGACACCACTCCCTGCTGCTTTGCCTACCTCTCCCTCGCGCTGCCTCGTGCCCACGT
CAAGGAGTATTTCTACACCAGCAGCAAGTGCTCCAATCTTGCAGTCGTGTTTGTCACTCGAAGGAACCGC
CAAGTGTGTGCCAACCCAGAGAAGAAGTGGGTTCAAGAATACATCAACTATTTGGAGATGAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_013653
ORF Size 276 bp
Insert Size 276
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013653.3, NP_038681
RefSeq Size 579
RefSeq ORF 276
Locus ID 20304
Cytogenetics 11 C|11 50.66 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.