Rps19 (NM_023133) Mouse Untagged Clone

CAT#: MC209334

Rps19 (untagged) - Mouse ribosomal protein S19 (Rps19), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rps19 (NM_023133) Mouse Untagged Clone
Symbol Rps19
Synonyms Dsk3
Vector pCMV6-Entry
Sequence Data
>MC209334 representing NM_023133
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCGGAGTTACTGTAAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAA
AGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGACACAGTCAAGCTGGCCAAACATAAAGAGCTTGCCCC
ATATGATGAGAACTGGTTCTACACACGAGCTGCTTCCACAGCACGGCACCTGTACCTCCGAGGTGGTGCT
GGGGTTGGTTCCATGACCAAGATCTATGGAGGACGGCAGAGAAACGGTGTCAGACCCAGCCATTTCAGCA
GAGGCTCTAAGAGTGTGGCCCGCCGGGTCCTCCAAGCCCTGGAGGGGCTGAAAATGGTGGAAAAGGACCA
AGATGGGGGCCGCAAGCTGACGCCTCAGGGACAGAGAGACCTGGACAGGATCGCTGGACAGGTGGCAGCT
GCCAACAAGAAGCATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_023133
ORF Size 438 bp
Insert Size 438
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_023133.1, NP_075622
RefSeq Size 629
RefSeq ORF 438
Locus ID 20085
Cytogenetics 7|7 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.