Rps19 (NM_023133) Mouse Untagged Clone

CAT#: MC209334

Rps19 (untagged) - Mouse ribosomal protein S19 (Rps19), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rps19
• Synonyms: Dsk3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209334 representing NM_023133
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCGGAGTTACTGTAAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAA
  AGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGACACAGTCAAGCTGGCCAAACATAAAGAGCTTGCCCC
  ATATGATGAGAACTGGTTCTACACACGAGCTGCTTCCACAGCACGGCACCTGTACCTCCGAGGTGGTGCT
  GGGGTTGGTTCCATGACCAAGATCTATGGAGGACGGCAGAGAAACGGTGTCAGACCCAGCCATTTCAGCA
  GAGGCTCTAAGAGTGTGGCCCGCCGGGTCCTCCAAGCCCTGGAGGGGCTGAAAATGGTGGAAAAGGACCA
  AGATGGGGGCCGCAAGCTGACGCCTCAGGGACAGAGAGACCTGGACAGGATCGCTGGACAGGTGGCAGCT
  GCCAACAAGAAGCATTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_023133
• Insert Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_023133.1, NP_075622.1
• RefSeq Size: 629 bp
• RefSeq ORF: 438 bp
• Locus ID: 20085
• UniProt ID: Q9CZX8
• Cytogenetics: 7 A3
• Gene Summary: Required for pre-rRNA processing and maturation of 40S ribosomal subunits.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 3, 4, and 5 all encode the same isoform (c). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.