Ran (NM_009391) Mouse Untagged Clone

CAT#: MC209291

Ran (untagged) - Mouse RAN, member RAS oncogene family (Ran), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ran
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209291 representing NM_009391
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGCCCAGGGAGAGCCGCAGGTCCAGTTCAAGCTCGTCCTGGTGGGCGACGGCGGCACCGGGAAGA
  CAACCTTCGTGAAGCGCCACTTGACGGGCGAGTTTGAGAAGAAGTATGTAGCCACCCTGGGCGTGGAGGT
  GCACCCGCTCGTCTTCCATACCAACAGAGGACCCATCAAGTTCAACGTGTGGGACACGGCCGGCCAGGAG
  AAGTTCGGGGGCCTGCGCGATGGCTACTACATCCAAGCCCAGTGTGCCATTATAATGTTTGATGTAACCT
  CAAGAGTTACTTACAAGAATGTACCTAACTGGCATAGAGATCTGGTACGAGTGTGTGAAAACATCCCCAT
  TGTATTGTGTGGCAACAAAGTGGATATTAAAGACAGGAAAGTGAAGGCAAAATCTATTGTCTTCCACCGG
  AAGAAGAATCTTCAGTACTATGACATTTCTGCCAAAAGTAACTACAACTTTGAAAAGCCTTTCCTCTGGC
  TTGCCAGAAAGCTCATTGGAGATCCTAACTTGGAGTTTGTTGCCATGCCTGCTCTTGCCCCACCTGAGGT
  GGTCATGGACCCAGCTTTGGCAGCACAGTACGAGCATGATTTAGAGGTTGCTCAGACGACTGCTCTCCCA
  GATGAGGATGATGACCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009391
• Insert Size: 651 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009391.3, NP_033417.1
• RefSeq Size: 2288 bp
• RefSeq ORF: 651 bp
• Locus ID: 19384
• UniProt ID: P62827
• Cytogenetics: 5 G1.3
• Gene Summary: GTPase involved in nucleocytoplasmic transport, participating both to the import and the export from the nucleus of proteins and RNAs. Switches between a cytoplasmic GDP- and a nuclear GTP-bound state by nucleotide exchange and GTP hydrolysis. Nuclear import receptors such as importin beta bind their substrates only in the absence of GTP-bound RAN and release them upon direct interaction with GTP-bound RAN, while export receptors behave in the opposite way. Thereby, RAN controls cargo loading and release by transport receptors in the proper compartment and ensures the directionality of the transport. Interaction with RANBP1 induces a conformation change in the complex formed by XPO1 and RAN that triggers the release of the nuclear export signal of cargo proteins. RAN (GTP-bound form) triggers microtubule assembly at mitotic chromosomes and is required for normal mitotic spindle assembly and chromosome segregation. Required for normal progress through mitosis. The complex with BIRC5/survivin plays a role in mitotic spindle formation by serving as a physical scaffold to help deliver the RAN effector molecule TPX2 to microtubules. Acts as a negative regulator of the kinase activity of VRK1 and VRK2. Enhances AR-mediated transactivation.[UniProtKB/Swiss-Prot Function]