Prx (NM_019412) Mouse Untagged Clone
CAT#: MC209241
Prx (untagged) - Mouse periaxin (Prx), transcript variant 2, (10ug)
"NM_019412" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Prx |
Synonyms | L-Periaxin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209241 representing NM_019412
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGCCAGGAGCCGCAGCGCTGAGGAGCTGAGACGGGCGGAGTTGGTGGAGATTATCGTGGAGACCG AGGCACAGACCGGGGTCAGCGGCTTCAACGTAGCAGGCGGCGGCAAAGAAGGAATCTTTGTCCGTGAGCT GCGAGAGGACTCACCGGCAGCTAAGAGCCTCAGCTTGCAAGAAGGGGACCAGCTGCTGAGTGCCCGTGTG TTCTTTGAGAACTTCAAATATGAGGATGCACTTCGCCTGCTGCAATGCGCAGAGCCCTACAAGGTCTCCT TCTGCTTGAAGCGCACTGTGCCCACCGGGGATCTGGCACTGAGGCCCGGGACGGTGTCTGGATACGAGAT GAAGGGCCCACGGGCCAAAGTGGCCAAGCTGGTACGCGTGCTTAGCCCGGTCCCGGTCCAGGACAGCCCC AGTGACCGGGTCGCTGCTGCGCCGTAA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_019412 |
Insert Size | 447 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019412.2, NP_062285.1 |
RefSeq Size | 5260 bp |
RefSeq ORF | 447 bp |
Locus ID | 19153 |
UniProt ID | O55103 |
Cytogenetics | 7 15.91 cM |
Gene Summary | Scaffolding protein that functions as part of a dystroglycan complex in Schwann cells, and as part of EZR and AHNAK-containing complexes in eye lens fiber cells (PubMed:11430802, PubMed:21745462, PubMed:22764250). Required for the maintenance of the peripheral myelin sheath that is essential for normal transmission of nerve impulses and normal perception of sensory stimuli (PubMed:10839370). Required for normal transport of MBP mRNA from the perinuclear to the paranodal regions (PubMed:15356632). Required for normal remyelination after nerve injury (PubMed:10839370). Required for normal elongation of Schwann cells and normal length of the internodes between the nodes of Ranvier. The demyelinated nodes of Ranvier permit saltatory transmission of nerve impulses; shorter internodes cause slower transmission of nerve impulses (PubMed:15356632, PubMed:23022068). Required for the formation of appositions between the abaxonal surface of the myelin sheath and the Schwann cell plasma membrane; the Schwann cell cytoplasm is restricted to regions between these appositions (PubMed:15356632, PubMed:23022068). Required for the formation of Cajal bands and of Schmidt-Lanterman incisures that correspond to short, cytoplasm-filled regions on myelinated nerves (PubMed:23022068, PubMed:22764250). Recruits DRP2 to the Schwann cell plasma membrane (PubMed:11430802, PubMed:23022068, PubMed:22764250). Required for normal protein composition of the eye lens fiber cell plasma membrane and normal eye lens fiber cell morphology (PubMed:21745462).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) represents the longer transcript but encodes the shorter isoform (S). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227573 | Prx (tGFP-tagged) - Mouse periaxin (Prx) transcript variant 2, (10ug) |
USD 425.00 |
|
MR227573 | Prx (Myc-DDK-tagged) - Mouse periaxin (Prx), transcript variant 2 |
USD 225.00 |
|
MR227573L3 | Lenti ORF clone of Prx (Myc-DDK-tagged) - Mouse periaxin (Prx), transcript variant 2 |
USD 525.00 |
|
MR227573L4 | Lenti ORF clone of Prx (mGFP-tagged) - Mouse periaxin (Prx), transcript variant 2 |
USD 525.00 |
{0} Product Review(s)
Be the first one to submit a review