Pou4f1 (NM_011143) Mouse Untagged Clone

CAT#: MC209204

Pou4f1 (untagged) - Mouse POU domain, class 4, transcription factor 1 (Pou4f1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pou4f1
• Synonyms: Brn-3; Brn-3.0; Brn3; Brn3.0; Brn3a; E130119J07Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209204 representing NM_011143
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGTCCATGAACAGCAAGCAGCCTCACTTTGCCATGCATCCCACCCTCCCTGAGCACAAGTACCCGT
  CGCTGCACTCCAGCTCCGAGGCCATCCGGCGGGCCTGCCTGCCCACGCCGCCGCTGCAGAGCAACCTCTT
  CGCCAGCCTGGACGAGACGCTGCTGGCGCGGGCCGAGGCGCTGGCGGCCGTGGACATCGCGGTGTCCCAG
  GGCAAGAGCCACCCTTTCAAGCCGGACGCCACGTACCACACGATGAATAGCGTGCCCTGCACGTCCACGT
  CCACCGTGCCGCTGGCGCACCACCACCACCACCACCACCACCACCAGGCGCTCGAGCCCGGTGACCTGCT
  GGACCACATCTCGTCGCCGTCGCTCGCGCTCATGGCCGGCGCAGGGGGCGCAGGCGCGGCGGGAGGCGGC
  GGCGGCGCCCACGACGGCCCCGGGGGCGGAGGCGGACCGGGGGGCGGCGGTGGCCCGGGCGGCGGCGGCC
  CCGGGGGTGGCGGCGGCGGCGGCGGCCCGGGGGGCGGCGGCGGCGGCCCGGGCGGCGGGCTCTTGGGCGG
  CTCGGCGCATCCGCACCCGCACATGCACGGCCTGGGCCACCTGTCGCACCCCGCGGCGGCGGCGGCCATG
  AACATGCCGTCCGGGCTGCCGCATCCCGGGCTCGTGGCCGCGGCGGCGCACCACGGCGCGGCGGCGGCAG
  CGGCGGCGGCGGCGGCGGGGCAGGTGGCGGCGGCGTCGGCCGCGGCGGCGGTGGTGGGCGCGGCGGGCCT
  GGCGTCCATCTGCGACTCGGACACGGACCCGCGCGAGCTCGAGGCGTTCGCCGAGCGCTTCAAGCAGCGG
  CGCATCAAGCTGGGCGTGACGCAGGCCGACGTGGGCTCGGCGCTGGCCAACCTCAAGATCCCGGGCGTGG
  GCTCGCTCAGCCAGAGCACCATCTGCAGGTTCGAGTCGCTCACGCTCTCGCACAACAACATGATCGCGCT
  CAAGCCCATCCTGCAGGCGTGGCTGGAGGAGGCCGAGGGCGCGCAGCGTGAGAAAATGAACAAGCCGGAG
  CTCTTCAACGGCGGCGAGAAGAAGCGCAAGCGGACTTCCATCGCCGCGCCCGAGAAGCGCTCCCTCGAGG
  CCTATTTTGCCGTACAACCCCGGCCCTCGTCTGAGAAGATCGCCGCCATCGCCGAGAAACTGGACCTCAA
  AAAGAACGTGGTGCGGGTGTGGTTTTGCAACCAGAGACAGAAGCAGAAGCGGATGAAATTCTCTGCCACT
  TACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011143
• Insert Size: 1266 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_011143.4, NP_035273.3
• RefSeq Size: 3801 bp
• RefSeq ORF: 1266 bp
• Locus ID: 18996
• UniProt ID: P17208
• Cytogenetics: 14 E2.3
• Gene Summary: Multifunctional transcription factor with different regions mediating its different effects (PubMed:10640682, PubMed:8621561, PubMed:9694219, PubMed:9722627). Acts by binding (via its C-terminal domain) to sequences related to the consensus octamer motif 5'-ATGCAAAT-3' in the regulatory regions of its target genes (PubMed:8621561, PubMed:17668438). Regulates the expression of specific genes involved in differentiation and survival within a subset of neuronal lineages. It has been shown that activation of some of these genes requires its N-terminal domain, maybe through a neuronal-specific cofactor (PubMed:12934100). Ativates BCL2 expression and protects neuronal cells from apoptosis (via the N-terminal domain) (PubMed:9722627). Induces neuronal process outgrowth and the coordinate expression of genes encoding synaptic proteins (PubMed:8972215). Exerts its major developmental effects in somatosensory neurons and in brainstem nuclei involved in motor control. Stimulates the binding affinity of the nuclear estrogene receptor ESR1 to DNA estrogen response element (ERE), and hence modulates ESR1-induced transcriptional activity (PubMed:9448000). May positively regulate POU4F2 and POU4F3 (PubMed:8876243). Regulates dorsal root ganglion sensory neuron specification and axonal projection into the spinal cord (PubMed:22326227). Plays a role in TNFSF11-mediated terminal osteoclast differentiation (PubMed:17668438). Negatively regulates its own expression interacting directly with a highly conserved autoregulatory domain surrounding the transcription initiation site (PubMed:12441296).[UniProtKB/Swiss-Prot Function]