Prkcz (NM_001039079) Mouse Untagged Clone

CAT#: MC209177

Prkcz (untagged) - Mouse protein kinase C, zeta (Prkcz), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prkcz
• Synonyms: AI098070; aPKCzeta; C80388; nPKC-zeta; Pkcz; R74924; zetaPKC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209177 representing NM_001039079
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATTCTGTCATGCCTTCCCAAGAGCCTCCAGTAGATGACAAGAACGATGGTGTAGACCTTCCTTCAG
  AAGAAACTGATGGAATTGCTTATATTTCTTCATCTCGGAAACATGATAATATCAAAGATGATTCTGAGGA
  CCTTAAGCCTGTCATCGATGGGGTGGATGGGATCAAAATCTCTCAGGGGCTGGGGCTGCAAGACTTCGAC
  CTCATCAGAGTCATCGGGCGTGGAAGCTATGCCAAGGTCCTCCTGGTGCGGTTGAAGAAAAACGACCAGA
  TTTACGCCATGAAGGTGGTAAAGAAGGAGCTTGTCCACGACGACGAGGATATCGACTGGGTGCAGACAGA
  GAAACATGTGTTTGAGCAGGCGTCCAGCAACCCCTTCCTGGTTGGCTTACACTCCTGCTTCCAGACAACG
  AGCCGGTTGTTCCTGGTCATCGAGTATGTCAATGGCGGGGACCTCATGTTCCACATGCAGAGGCAGAGAA
  AACTTCCAGAGGAGCATGCCAGGTTCTATGCTGCTGAGATCTGTATCGCTCTCAACTTCTTGCATGAGAG
  GGGGATCATCTACCGGGACCTAAAACTGGACAACGTCCTCCTTGATGCCGACGGACACATTAAGCTGACG
  GACTACGGCATGTGCAAGGAAGGTCTAGGCCCCGGTGATACAACAAGCACTTTTTGTGGAACCCCGAACT
  ATATCGCCCCCGAAATCCTGCGAGGAGAAGAGTACGGGTTCAGCGTGGACTGGTGGGCACTGGGTGTCCT
  TATGTTTGAGATGATGGCTGGGCGCTCCCCCTTTGACATCATCACGGACAACCCTGACATGAACACTGAA
  GACTACCTTTTCCAAGTTATCCTGGAAAAGCCAATCCGGATTCCCCGTTTCCTGTCTGTCAAGGCCTCAC
  ACGTCTTAAAAGGATTTTTAAATAAGGATCCCAAAGAGAGGCTTGGCTGCCGGCCACAGACTGGGTTTTC
  CGACATCAAGTCTCATGCTTTCTTCCGCAGCATAGACTGGGACCTGCTGGAAAAGAAGCAGACCCTGCCT
  CCCTTCCAGCCCCAGATCACAGATGACTATGGCCTGGACAACTTTGACACGCAGTTCACCAGCGAGCCTG
  TGCAGCTGACCCCAGATGATGAGGACGTCATAAAGAGGATCGACCAGTCCGAATTTGAAGGCTTTGAGTA
  CATCAACCCACTTCTGCTGTCTGCTGAGGAGTCCGTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039079
• Insert Size: 1230 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001039079.2, NP_001034168.1
• RefSeq Size: 4111 bp
• RefSeq ORF: 1230 bp
• Locus ID: 18762
• Cytogenetics: 4 86.17 cM
• Gene Summary: Calcium- and diacylglycerol-independent serine/threonine-protein kinase that functions in phosphatidylinositol 3-kinase (PI3K) pathway and mitogen-activated protein (MAP) kinase cascade, and is involved in NF-kappa-B activation, mitogenic signaling, cell proliferation, cell polarity, inflammatory response and maintenance of long-term potentiation (LTP). Upon lipopolysaccharide (LPS) treatment in macrophages, or following mitogenic stimuli, functions downstream of PI3K to activate MAP2K1/MEK1-MAPK1/ERK2 signaling cascade independently of RAF1 activation. Required for insulin-dependent activation of AKT3, but may function as an adapter rather than a direct activator. Upon insulin treatment may act as a downstream effector of PI3K and contribute to the activation of translocation of the glucose transporter SLC2A4/GLUT4 and subsequent glucose transport in adipocytes. In EGF-induced cells, binds and activates MAP2K5/MEK5-MAPK7/ERK5 independently of its kinase activity and can activate JUN promoter through MEF2C. Through binding with SQSTM1/p62, functions in interleukin-1 signaling and activation of NF-kappa-B with the specific adapters RIPK1 and TRAF6. Participates in TNF-dependent transactivation of NF-kappa-B by phosphorylating and activating IKBKB kinase, which in turn leads to the degradation of NF-kappa-B inhibitors. In migrating astrocytes, forms a cytoplasmic complex with PARD6A and is recruited by CDC42 to function in the establishment of cell polarity along with the microtubule motor and dynein. In association with FEZ1, stimulates neuronal differentiation in PC12 cells. In the inflammatory response, is required for the T-helper 2 (Th2) differentiation process, including interleukin production, efficient activation of JAK1 and the subsequent phosphorylation and nuclear translocation of STAT6. May be involved in development of allergic airway inflammation (asthma), a process dependent on Th2 immune response. In the NF-kappa-B-mediated inflammatory response, can relieve SETD6-dependent repression of NF-kappa-B target genes by phosphorylating the RELA subunit at 'Ser-311'. In vein endothelial cells treated with the oxidant peroxynitrite, phosphorylates STK11 leading to nuclear export of STK11, subsequent inhibition of PI3K/Akt signaling, and increased apoptosis. Phosphorylates VAMP2 in vitro (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate 5' exon structure and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform b, which is shorter at the N-terminus compared to isoform a.