Prkacb (NM_001164200) Mouse Untagged Clone

CAT#: MC209175

Prkacb (untagged) - Mouse protein kinase, cAMP dependent, catalytic, beta (Prkacb), transcript variant 4, (10ug)


  "NM_001164200" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PRKACB Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Prkacb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Prkacb
Synonyms CbPKA; Pkacb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209175 representing NM_001164200
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCTCACAAAGAACTGTCCAGTGGCCAGCACAGTGGCACGCCCACCGCCCTCCAGAAGCTGGAGG
GGTTCGCTAGCCGCCTGTTTCACAGGCACTCCAGAGGCACCGCACAAGAGCACAGGGCAGCTCTGGAAGA
TGACGGCCTTCGGGCCTCTGAGCACACTGCCTCATGGGACAAATCAATGAAAGAGTTTCTAGCCAAAGCC
AAAGAAGACTTTCTGAGGAAATGGGAGAACCCTCCCCCGAGTAATGCTGGGCTTGAGGATTTTGAGAGGA
AGAAAACCCTCGGGACGGGTTCCTTTGGAAGAGTCATGTTGGTGAAGCATAAAGCCACTGAGCAGTACTA
CGCCATGAAGATCTTAGACAAGCAGAAGGTTGTTAAGCTGAAGCAAATAGAGCACACTCTGAATGAGAAG
AGAATCCTGCAGGCCGTGGAGTTCCCGTTCCTTGTGCGGCTGGAGTACTCTTTTAAGGATAATTCTAATT
TATACATGGTTATGGAATACGTCCCTGGGGGAGAGATGTTCTCACATCTGAGAAGAATTGGAAGGTTCAG
TGAGCCCCACGCCCGTTTCTATGCAGCCCAGATTGTGCTAACATTTGAGTACCTTCATTCCCTCGACCTC
ATCTACAGAGATCTCAAGCCGGAAAACCTCTTAATTGACCACCAGGGTTACATCCAGGTCACAGATTTCG
GGTTCGCCAAAAGAGTCAAGGGCAGGACATGGACATTGTGTGGCACCCCAGAGTACCTGGCCCCGGAGAT
CATCCTCAGCAAGGGTTACAATAAGGCGGTGGACTGGTGGGCACTGGGCGTGCTGATCTATGAGATGGCT
GCTGGCTACCCTCCATTCTTTGCTGACCAGCCAATTCAGATCTATGAGAAGATTGTCTCTGGAAAGGTCC
GGTTCCCATCACACTTCAGCTCCGATCTCAAGGACCTTCTGCGGAACCTGCTGCAGGTGGATCTGACAAA
GCGATTCGGGAACCTGAAGAACGGCGTGAGTGACATAAAGACCCACAAGTGGTTTGCCACAACTGACTGG
ATTGCTATTTATCAGAGAAAGGTTGAGGCTCCATTCATACCAAAGTTCAGAGGCTCTGGCGATACCAGCA
ACTTCGATGACTATGAAGAAGAAGAAATCCGTGTGTCTATAACAGAAAAATGTGGAAAGGAATTTTGTGA
ATTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164200
Insert Size 1197 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164200.1, NP_001157672.1
RefSeq Size 4302 bp
RefSeq ORF 1197 bp
Locus ID 18749
UniProt ID P68181
Cytogenetics 3 H2
Gene Summary Mediates cAMP-dependent signaling triggered by receptor binding to GPCRs. PKA activation regulates diverse cellular processes such as cell proliferation, the cell cycle, differentiation and regulation of microtubule dynamics, chromatin condensation and decondensation, nuclear envelope disassembly and reassembly, as well as regulation of intracellular transport mechanisms and ion flux (PubMed:9368018). Regulates the abundance of compartmentalized pools of its regulatory subunits through phosphorylation of PJA2 which binds and ubiquitinates these subunits, leading to their subsequent proteolysis. Phosphorylates GPKOW which regulates its ability to bind RNA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternative exon at the 5' end compared to variant 1. The resulting isoform (4) has a distinct and longer N-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.