Pcp2 (NM_008790) Mouse Untagged Clone
CAT#: MC209152
Pcp2 (untagged) - Mouse Purkinje cell protein 2 (L7) (Pcp2), transcript variant 3, (10ug)
"NM_008790" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pcp2 |
Synonyms | L7; Pcp-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209152 representing NM_008790
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGAGCAGCGCTGTTCCTTGCAGGCTGGGCCAGGCCAGAACCCAGAAAGCCAGGGTGGCCCTGCTC CAGAGATGGACAATCTCATGGATATGCTGGTCAACACCCAGGGCCGCCGCATGGACGACCAGCGTGTAAC AGTTAATTCCCTGCCTGGCTTCCAACCTATCGGCCCCAAGGATGGAATGCAGAAACGACCTGGGACCCTC AGCCCTCAACCCCTGCTCACCCCTCAGGATCCTGCTGCACTCAGCTTCCGCAGGAACAGCAGCCCCCAGC CCCAGACACAAGCTCCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008790 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008790.2, NP_032816.1 |
RefSeq Size | 513 bp |
RefSeq ORF | 300 bp |
Locus ID | 18545 |
UniProt ID | P12660 |
Cytogenetics | 8 1.92 cM |
Gene Summary | May function as a cell-type specific modulator for G protein-mediated cell signaling.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) includes an alternate exon in the 5' end and uses a downstream start codon, compared to variant 1. It encodes isoform 3 which has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220737 | Pcp2 (tGFP-tagged) - Mouse Purkinje cell protein 2 (L7) (Pcp2) transcript variant 3, (10ug) |
USD 365.00 |
|
MR220737 | Pcp2 (Myc-DDK-tagged) - Mouse Purkinje cell protein 2 (L7) (Pcp2), transcript variant 3 |
USD 165.00 |
|
MR220737L3 | Lenti ORF clone of Pcp2 (Myc-DDK-tagged) - Mouse Purkinje cell protein 2 (L7) (Pcp2), transcript variant 3 |
USD 465.00 |
|
MR220737L4 | Lenti ORF clone of Pcp2 (mGFP-tagged) - Mouse Purkinje cell protein 2 (L7) (Pcp2), transcript variant 3 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review