Olfr16 (NM_008763) Mouse Untagged Clone
CAT#: MC209078
Olfr16 (untagged) - Mouse olfactory receptor 16 (Olfr16), (10ug)
"NM_008763" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Olfr16 |
Synonyms | MOR23; MOR26713 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_008763, the custom clone sequence may differ by one or more nucleotides
ATGCAGAGAAATAACTTCACTGAAGTGATAGAGTTCGTCTTCCTGGGATTCTCCAGCTTTGGAAAGCATC AGATAACCCTCTTTGTGGTTTTCCTAACCATCTACATTTTAACTCTGGCTGGCAACATCATTATAGTGAC AATCACACACATAGACCACCACCTTCACACTCCCATGTACTTCTTTCTGAGCATGTTGGCAAGCTCAGAG ACTGTGTACACACTGGTCATTGTCCCACGAATGCTTTCCAGCCTGATTTTTTACAACCTTCCCATATCCT TGGCAGGCTGCGCAACCCAAATGTTCTTTTTTGTCACTTTGGCCACCAACAACTGCTTTCTGCTCACAGC AATGGGTTATGATCGTTATGTGGCTATTTGTAATCCTCTGAGATATACAATCATCATGAGCAAGGGAATG TGTGCCTTGTTGGTCTGTGGGTCTTTAGGCACTGGCCTGGTTATGGCAGTTCTTCATGTGCCAGCCATGT TCCATTTGCCCTTTTGTGGCACGGTGGTGGAGCACTTTTTCTGTGACATATACCCAGTAATGAAGCTTTC TTGTGTTGATACCACTGTCAATGAGATAATCAATTATGGTGTAAGTTCATTTGTAATTCTTGTGCCCATA GGGCTGATATTTATCTCCTATGTGCTCATTGTCTCTTCCATCCTTAAAATTGTGTCCACTGAAGGCCAGA AGAAAGCCTTTGCCACCTGTGCCTCTCATCTCACTGTGGTCATTGTCCACTATGGCTGTGCCTCCATTGC CTACCTCAAACCCAAATCAGAAAGTTCAGTAGAAAAAGACCTTCTTCTCTCTGTGACCTACACTATCATC ACTCCCTTGCTGAACCCTGTTGTCTACAGCCTCAGGAACAAAGAAGTCAAAGATGCTCTATGCAGAGCTG TGGGCAGAAACACTTCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008763 |
Insert Size | 930 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC119298, AAI19299 |
RefSeq Size | 1050 bp |
RefSeq ORF | 930 bp |
Locus ID | 18313 |
Cytogenetics | 1 H3 |
Gene Summary | Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226863 | Olfr16 (tGFP-tagged) - Mouse olfactory receptor 16 (Olfr16), (10ug) |
USD 500.00 |
|
MR226863 | Olfr16 (Myc-DDK-tagged) - Mouse olfactory receptor 16 (Olfr16) |
USD 300.00 |
|
MR226863L3 | Lenti ORF clone of Olfr16 (Myc-DDK-tagged) - Mouse olfactory receptor 16 (Olfr16) |
USD 600.00 |
|
MR226863L4 | Lenti ORF clone of Olfr16 (mGFP-tagged) - Mouse olfactory receptor 16 (Olfr16) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review