Nkx3-1 (NM_010921) Mouse Untagged Clone

CAT#: MC209041

Nkx3 (untagged) - Mouse NK-3 transcription factor, locus 1 (Drosophila) (Nkx3-1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nkx3-1
• Synonyms: bagpipe; Bax; Nkx-3.1; NKX3.1; NKX3A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209041 representing NM_010921
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTTAGGGTAGCGGAGCCCCGAGAGCCACGGGTGGAGGCGGGTGGCCGCAGTCCTTGGGCAGCGCCAC
  CCACGCAGTCCAAGCGGCTCACCTCCTTCCTCATCCAGGACATCCTGCGGGACCGCGCGGAGCGGCACGG
  GGGACACTCAGGCAATCCGCAGCACTCGCCGGACCCTAGGAGGGACTCCGCTCCAGAGCCCGACAAAGCA
  GGGGGTCGCGGCGTGGCTCCGGAGGACCCACCAAGTATCCGGCATAGCCCCGCGGAGACACCGACTGAAC
  CCGAGTCTGATGCACATTTTGAGACTTATCTTTTGGACTGTGAACATAATCCAGGGGACTTAGCAAGTGC
  CCCCCAGGTCACCAAGCAGCCACAGAAGCGCTCCCGGGCCGCCTTCTCTCACACTCAGGTGATTGAGTTG
  GAGAGGAAGTTCAGCCATCAGAAGTACCTGTCTGCCCCTGAGAGGGCTCACCTGGCCAAGAACCTCAAAC
  TCACCGAAACCCAAGTCAAAATATGGTTCCAGAACAGACGCTATAAGACCAAGCGAAAGCAGCTGTCGGA
  AGACCTGGGAGTCTTGGAGAAGAACTCACCATTGTCTTTGCCAGCCCTGAAAGATGACAGCCTGCCCAGT
  ACCTCCTTGGTCTCCGTGTATACTAGCTATCCCTACTACCCCTACCTGTACTGTCTGGGCAGCTGGCATC
  CATCTTTCTGGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010921
• Insert Size: 714 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010921.3, NP_035051.1
• RefSeq Size: 3137 bp
• RefSeq ORF: 714 bp
• Locus ID: 18095
• UniProt ID: P97436
• Cytogenetics: 14 36.02 cM
• Gene Summary: Transcription factor, which binds preferentially the consensus sequence 5'-TAAGT[AG]-3' and can behave as a transcriptional repressor (By similarity). Plays an important role in normal prostate development, regulating proliferation of glandular epithelium and in the formation of ducts in prostate. Acts as a tumor suppressor controlling prostate carcinogenesis, as shown by the ability to suppress growth and tumorigenicity of prostate carcinoma cells. Plays a role in the formation of minor salivary glands (particularly palatine and lingual glands). Essential for appropriate differentiation and secretory function of the bulbourethral gland.[UniProtKB/Swiss-Prot Function]