Sept2 (NM_001159719) Mouse Untagged Clone

CAT#: MC209018

41519 (untagged) - Mouse septin 2 (Sept2), transcript variant 1, (10ug)


  "NM_001159719" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sept2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sept2
Synonyms AW208991; mKIAA0158; Nedd-5; Nedd5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209018 representing NM_001159719
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTAAGCAACAACCAACTCAGTTTATAAATCCAGAAACTCCTGGCTATGTTGGATTTGCAAATCTTC
CCAATCAAGTTCACCGAAAATCAGTGAAGAAGGGGTTCGAGTTCACTCTGATGGTGGTTGGTGAATCTGG
TCTAGGAAAATCAACTCTCATAAACAGCTTATTCCTGACTGATCTCTACCCAGAAAGAATTATTCCTGGA
GCTGCAGAGAAAATTGAAAGAACTGTCCAGATAGAGGCTTCGACTGTTGAGATTGAAGAGCGGGGTGTGA
AGCTGCGGCTTACAGTAGTGGACACTCCCGGCTACGGGGATGCCATCAACTGCAGGGATTGTTTCAAGAC
AATTATCTCCTACATTGATGAGCAGTTTGAACGCTACCTACATGATGAGAGTGGACTGAACAGGCGTCAC
ATCATTGATAACAGGGTACATTGTTGCTTCTACTTCATTTCACCTTTTGGACATGGACTGAAGCCCTTAG
ATGTTGCATTTATGAAAGCGATACACAATAAGGTGAATATTGTGCCTGTCATTGCGAAAGCTGACACTCT
CACTCTGAAGGAGCGTGAGCGGCTTAAGAAAAGGATTTTGGATGAAATTGAAGAGCATAGCATTAAAATC
TATCACTTACCTGATGCAGAGTCAGATGAAGATGAAGACTTTAAGGAGCAGACTAGACTCCTCAAGGCCA
GTATCCCATTCTCTGTGGTTGGCTCCAACCAGTTGATTGAAGCCAAAGGCAAGAAGGTTAGAGGCCGTCT
CTACCCATGGGGTGTTGTAGAGGTGGAGAACCCAGAACACAATGACTTTCTGAAGCTGAGAACGATGCTC
ATCACCCACATGCAGGACCTACAGGAAGTGACCCAAGACCTTCACTATGAAAACTTCCGTTCTGAGAGGC
TGAAGAGAGGCGGCAGGAAAGTAGAGAATGAGGACATGAATAAAGACCAGATCTTGCTTGAAAAGGAGGC
TGAGCTCCGCCGCATGCAAGAGATGATTGCAAGAATGCAAGCGCAGATGCAGATGCAGATGCAGGGTGGT
GACAGTGACAGCGGGGCTCTCGGGCAGCATGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001159719
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001159719.1, NP_001153191.1
RefSeq Size 3267 bp
RefSeq ORF 1086 bp
Locus ID 18000
UniProt ID P42208
Cytogenetics 1 D
Gene Summary Filament-forming cytoskeletal GTPase. Forms a filamentous structure with SEPTIN12, SEPTIN6, SEPTIN2 and probably SEPTIN4 at the sperm annulus which is required for the structural integrity and motility of the sperm tail during postmeiotic differentiation (By similarity). Required for normal organization of the actin cytoskeleton. Plays a role in the biogenesis of polarized columnar-shaped epithelium by maintaining polyglutamylated microtubules, thus facilitating efficient vesicle transport, and by impeding MAP4 binding to tubulin. Required for the progression through mitosis. Forms a scaffold at the midplane of the mitotic splindle required to maintain CENPE localization at kinetochores and consequently chromosome congression. During anaphase, may be required for chromosome segregation and spindle elongation. Plays a role in ciliogenesis and collective cell movements (By similarity). In cilia, required for the integrity of the diffusion barrier at the base of the primary cilium that prevents diffusion of transmembrane proteins between the cilia and plasma membranes: probably acts by regulating the assembly of the tectonic-like complex (also named B9 complex) by localizing TMEM231 protein.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.