Naca (NM_013608) Mouse Untagged Clone
CAT#: MC209009
Naca (untagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (Naca), transcript variant 2, (10ug)
"NM_013608" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Naca |
Synonyms | AL022831; AL024382; Gm1878; mKIAA0363; skNAC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209009 representing NM_013608
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCGGTGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCACAGCCTCAGGCTGAGACAG GATCGGGAACAGAGTCTGACAGTGATGAGTCAGTACCAGAGCTCGAGGAACAAGACTCCACACAGACGGC CACGCAGCAAGCCCAGCTGGCAGCCGCAGCAGAGATCGATGAAGAACCTGTTAGTAAAGCCAAGCAGAGT CGAAGTGAGAAGAAGGCAAGGAAGGCTATGTCCAAACTGGGTCTTCGACAGGTTACAGGGGTTACGAGAG TCACTATCCGAAAATCTAAAAATATCCTCTTTGTCATCACAAAACCCGATGTCTACAAGAGCCCAGCTTC AGACACCTACATAGTGTTTGGGGAAGCCAAGATTGAAGATTTGTCTCAGCAAGCACAGTTAGCAGCTGCT GAGAAATTCAAAGTTCAAGGTGAAGCTGTTTCAAACATTCAGGAAAACACTCAGACTCCAACCGTCCAAG AGGAGAGTGAAGAAGAGGAGGTTGATGAGACGGGTGTGGAAGTTAAGGACATAGAACTGGTCATGTCGCA AGCAAACGTATCAAGAGCAAAGGCTGTTCGAGCCCTGAAAAACAACAGTAATGATATTGTAAATGCTATT ATGGAATTAACAATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013608 |
Insert Size | 648 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013608.3, NP_038636.2 |
RefSeq Size | 1118 bp |
RefSeq ORF | 648 bp |
Locus ID | 17938 |
UniProt ID | Q60817 |
Cytogenetics | 10 D3 |
Gene Summary | Prevents inappropriate targeting of non-secretory polypeptides to the endoplasmic reticulum (ER). Binds to nascent polypeptide chains as they emerge from the ribosome and blocks their interaction with the signal recognition particle (SRP), which normally targets nascent secretory peptides to the ER. Also reduces the inherent affinity of ribosomes for protein translocation sites in the ER membrane (M sites) (By similarity). Isoform 1 and isoform 2 appear to bind DNA and play roles in transcription. Isoform 1 may function as a specific coactivator for JUN, acting to stabilize the interaction of JUN homodimers with promoter elements.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal in-frame large exon in the coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a. Variants 2 and 3 encode the same isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR202376 | Naca (Myc-DDK-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (Naca), transcript variant 2 |
USD 300.00 |
|
MR202376L3 | Lenti ORF clone of Naca (Myc-DDK-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (Naca), transcript variant 2 |
USD 600.00 |
|
MR202376L4 | Lenti ORF clone of Naca (mGFP-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (Naca), transcript variant 2 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review