Meis2 (NM_001159567) Mouse Untagged Clone

CAT#: MC208974

Meis2 (untagged) - Mouse Meis homeobox 2 (Meis2), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Meis2
• Synonyms: A430109D20Rik; Mei; Mrg; Mrg1; Str; Stra10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208974 representing NM_001159567
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCAAAGGTACGATGAGCTGCCCCATTACGGCGGGATGGACGGAGTAGGGGTTCCCGCTTCCATGT
  ACGGAGACCCTCACGCGCCGCGGCCGATCCCCCCGGTTCACCACCTAAACCACGGGCCGCCGCTCCACGC
  CACGCAGCACTACGGCGCGCACGCCCCGCACCCCAATGTCATGCCAGCCAGCATGGGATCTGCTGTCAAC
  GACGCCTTGAAAAGAGACAAGGACGCAATCTATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTTTTTG
  AGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCCGGAGTGGCCGGCGGAGACGTCTGTTCCTCTGA
  CTCCTTCAACGAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAAAAGCCTCTTTTTTCCTCAAAC
  CCAGAGCTGGATAATTTGATGATACAAGCAATTCAAGTACTAAGGTTTCATCTTCTGGAGTTAGAAAAGG
  TCCACGAACTATGTGATAACTTCTGCCACCGGTACATTAGCTGTTTGAAGGGAAAAATGCCCATTGACCT
  CGTGATTGATGAGAGAGATGGAAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACAAATCTC
  GCCGACCACAACCCTTCATCCTGGCGAGACCACGATGACGCAACCTCAACGCACTCCGCAGGCACCCCAG
  GACCCTCCAGTGGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGTGAGCAAGGCGATGGGTTAGACAA
  CAGCGTAGCTTCACCTGGCACAGGTGATGACGACGATCCAGACAAGGACAAAAAACGCCAGAAGAAAAGA
  GGCATATTCCCCAAAGTCGCGACAAATATCATGAGAGCGTGGCTCTTCCAGCATCTCACACACCCGTACC
  CTTCAGAAGAACAGAAGAAACAGTTAGCGCAAGACACGGGACTGACAATTCTGCAAGTGAACAACTGGTT
  TATCAATGCCAGAAGAAGAATAGTGCAGCCCATGATTGACCAGTCAAATCGAGCAGGTTTTCTTCTTGAT
  CCTTCAGTGAGCCAAGGAGCAGCGTATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGTC
  AGCAACACATGGGGATCCGGCCTGCAGGACCCATGAGTGGAATGGGCATGAATATGGGCATGGATGGGCA
  GTGGCACTATATGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001159567
• Insert Size: 1206 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001159567.1, NP_001153039.1
• RefSeq Size: 4737 bp
• RefSeq ORF: 1206 bp
• Locus ID: 17536
• UniProt ID: P97367
• Cytogenetics: 2 58.28 cM
• Gene Summary: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and has multiple differences in the coding region, compared to variant 9. The encoded isoform (3) is shorter and has distinct N- and C-termini compared to isoform 9. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.