Mocs2 (NM_001113375) Mouse Untagged Clone

CAT#: MC208969

Mocs2 (untagged) - Mouse molybdenum cofactor synthesis 2 (Mocs2), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mocs2
• Synonyms: AI415403
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208969 representing NM_001113375
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGAGCTTGGAGATCAGCAACTCCTGCTTCAGCCCGGAGATGAGGTTGCCATCATCCCGCCAATCAG
  TGGAGGATAATGCATCTGAGCCATCTGGGAAAGATGTGGACGATGTCCAGGAGAAACCTAAAGACATAAT
  ACAGTTCACTGCCGAGAAGCTCTCTGTGGGGGAAGTGTCACAGTTGGTGGTGTCCCCTCTGTGTGGTGCA
  GTGTCTCTCTTTGTAGGGACTACAAGAAATAACTTTGAAGGCAAGAAAGTCATTAGCTTAGAATATGAAG
  CTTTGGTTCCAGTGTCAGAAGCAAGCACAGTTATTGCTGTGTCTTCAGCTCACAGAGCCGCGTCCCTCGA
  AGCCGTGAGCTACGCCATTGATTCTTTAAAAGCCAAGGTGCCCATATGGAAAAAGGAAATATATGAAGAA
  TCAACCTCATCTTGGAAAAGAAACAAAGAGTGCTTCTGGGCAGCTGGTGACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001113375
• Insert Size: 474 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001113375.1, NP_001106846.1
• RefSeq Size: 1671 bp
• RefSeq ORF: 474 bp
• Locus ID: 17434
• Cytogenetics: 13 D2.2
• Gene Summary: Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. Based on experiments with the human molybdopterin synthase ortholog, they are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks an alternate exon in the 5' end and uses an alternate in-frame splice site in the 3' end, compared to variant 1. Variant 3 encodes a variant of the large subunit (Mocs2B2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.