Bhlha15 (NM_010800) Mouse Untagged Clone

CAT#: MC208962

Bhlha15 (untagged) - Mouse basic helix-loop-helix family, member a15 (Bhlha15), (10ug)


  "NM_010800" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Bhlha15"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bhlha15
Synonyms 1810009C13Rik; Bhlhb8; MIST-1; Mist1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208962 representing NM_010800
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGACCAAAAACCGGCCCCCTCGGCGCCGAACACCCATGCAGGACACAGAAGCCACCCCAGGAGAGC
AGACACCTGACAGACCCCAGTCAGGCTCAGGGGGGTCAGAGCTGACAAAGGGTCTCCGGAGCAGGACAGC
GCGTGCAAGCGGAGGTCGGGGAGAGGTCAGCCGCCGGCGACAGGGGTCTGGTGGCCGCAGGGAGAACAGT
GTTCAGAGGCGGCTGGAGAGCAATGAGCGAGAGAGGCAGCGGATGCATAAACTCAACAATGCCTTCCAGG
CACTGCGCGAGGTCATCCCGCACGTGCGGGCTGACAAGAAGCTCTCCAAGATCGAGACCCTCACGCTGGC
CAAGAACTATATCAAGTCGCTGACCGCCACCATACTTACTATGTCCAGCAGCCGCCTCCCGGGGCTGGAG
GCACCAGGTCCTGCGCCAGGCCCTAAATTATACCAGCACTACCATCACCAGCAGCAGCAACAGCAGCAGC
AGCAGCAGGTAGCTGGGGCCATGCTTGGTGTCACTGAGGACCAGCCCCAAGGCCACCTGCAACGCTACTC
TACACAGATCCACAGCTTCAGAGAGGGGAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_010800
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010800.4, NP_034930.1
RefSeq Size 3494 bp
RefSeq ORF 594 bp
Locus ID 17341
UniProt ID Q9QYC3
Cytogenetics 5 G2
Gene Summary Plays a role in controlling the transcriptional activity of MyoD, ensuring that expanding myoblast populations remain undifferentiated (PubMed:17612490). Repression may occur through muscle-specific E-box occupancy by homodimers. May also negatively regulate bHLH-mediated transcription through an N-terminal repressor domain. Serves as a key regulator of acinar cell function, stability, and identity. Also required for normal organelle localization in exocrine cells and for mitochondrial calcium ion transport. May function as a unique regulator of gene expression in several different embryonic and postnatal cell lineages. Binds to the E-box consensus sequence 5'-CANNTG-3'.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.