Meis1 (NM_001193271) Mouse Untagged Clone

CAT#: MC208957

Meis1 (untagged) - Mouse Meis homeobox 1 (Meis1), transcript variant B, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Meis1
• Synonyms: C530044H18Rik; Evi8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208957 representing NM_001193271
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCAAAGGTACGACGACCTACCCCATTATGGGGGTATGGATGGAGTAGGCATCCCCTCCACGATGT
  ATGGGGACCCGCATGCAGCCAGGTCCATGCAACCGGTCCACCACCTGAACCACGGGCCTCCTCTGCACTC
  GCATCAGTACCCGCACACAGCTCACACCAACGCCATGGCCCCCAGCATGGGTTCCTCGGTCAATGACGCT
  TTAAAGAGAGATAAAGATGCCATTTATGGACACCCCCTCTTCCCTCTCTTAGCACTGATTTTTGAGAAAT
  GTGAATTAGCTACTTGTACCCCCCGCGAGCCGGGGGTGGCGGGCGGGGACGTCTGCTCGTCAGAGTCATT
  CAATGAAGATATAGCGGTGTTCGCCAAACAGATTCGCGCAGAAAAACCTCTATTCTCTTCTAATCCAGAA
  CTGGATAACTTGATGATTCAAGCCATACAAGTGTTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACG
  AATTATGTGACAATTTCTGCCACCGGTATATTAGCTGTTTGAAAGGGAAAATGCCTATCGATTTGGTGAT
  AGATGATAGAGAAGGAGGATCAAAATCAGACAGTGAAGATGTAACAAGATCAGCAAATCTAACTGACCAG
  CCCTCTTGGAATAGAGACCATGATGACACGGCATCCACTCGTTCAGGAGGAACCCCGGGCCCTTCCAGCG
  GTGGCCATACTTCACACAGTGGGGATAACAGCAGTGAGCAAGGTGATGGCTTGGACAACAGTGTAGCTTC
  CCCCAGCACAGGTGACGATGATGACCCTGATAAGGACAAAAAGCGTCACAAAAAGCGTGGCATCTTTCCC
  AAAGTAGCCACCAATATCATGAGGGCGTGGCTGTTCCAGCATCTAACACACCCTTACCCTTCTGAAGAAC
  AGAAAAAGCAGTTGGCACAAGATACAGGACTTACCATCCTTCAAGTGAACAATTGGTTTATTAATGCCCG
  GAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGTCAGCCAAGGGACACCTTATAACCCT
  GATGGACAGCCAATGGGAGGTTTTGTAATGGACGGTCAGCAGCACATGGGCATCAGAGCGCCAGGACCTA
  TGAGTGGAATGGGCATGAATATGGGCATGGAGGGGCAGTGGCACTACATGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193271
• Insert Size: 1173 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001193271.1, NP_001180200.1
• RefSeq Size: 3441 bp
• RefSeq ORF: 1173 bp
• Locus ID: 17268
• UniProt ID: Q60954
• Cytogenetics: 11 11.11 cM
• Gene Summary: Acts as a transcriptional regulator of PAX6. Also acts as a transcriptional activator of PF4 in complex with PBX1 or PBX2. Required for hematopoiesis, megakaryocyte lineage development and vascular patterning. May function as a cofactor for HOXA7 and HOXA9 in the induction of myeloid leukemias.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: : This variant (B) includes an alternate exon in the 3' coding region, which results in a frameshift, compared to variant A. The resulting protein (isoform B) has a shorter and distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.