Ascl1 (NM_008553) Mouse Untagged Clone

CAT#: MC208938

Ascl1 (untagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1), (10ug)


  "NM_008553" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ascl1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ascl1
Synonyms AI225900; ASH1; bHLHa46; Mash1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208938 representing NM_008553
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAGCTCTGGCAAGATGGAGAGTGGAGCCGGCCAGCAGCCGCAGCCCCCGCAGCCCTTCCTGCCTC
CCGCAGCCTGCTTCTTTGCGACCGCGGCGGCGGCGGCAGCGGCGGCGGCCGCGGCAGCTCAGAGCGCGCA
GCAGCAACAGCCGCAGGCGCCGCCGCAGCAGGCGCCGCAGCTGAGCCCGGTGGCCGACAGCCAGCCCTCA
GGGGGCGGTCACAAGTCAGCGGCCAAGCAGGTCAAGCGCCAGCGCTCGTCCTCTCCGGAACTGATGCGCT
GCAAACGCCGGCTCAACTTCAGCGGCTTCGGCTACAGCCTGCCACAGCAGCAGCCGGCCGCCGTGGCGCG
CCGCAACGAGCGCGAGCGCAACCGGGTCAAGTTGGTCAACCTGGGTTTTGCCACCCTCCGGGAGCATGTC
CCCAACGGCGCGGCCAACAAGAAGATGAGCAAGGTGGAGACGCTGCGCTCGGCGGTCGAGTACATCCGCG
CGCTGCAGCAGCTGCTGGACGAGCACGACGCGGTGAGCGCTGCCTTTCAGGCGGGCGTCCTGTCGCCCAC
CATCTCCCCCAACTACTCCAACGACTTGAACTCTATGGCGGGTTCTCCGGTCTCGTCCTACTCCTCCGAC
GAGGGATCCTACGACCCTCTTAGCCCAGAGGAACAAGAGCTGCTGGACTTTACCAACTGGTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_008553
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC055748, AAH55748
RefSeq Size 2028 bp
RefSeq ORF 696 bp
Locus ID 17172
UniProt ID Q02067
Cytogenetics 10 C1
Gene Summary Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways (PubMed:24243019). Directly binds the E box motif (5'-CANNTG-3') on promoters and promotes transcription of neuronal genes (PubMed:20107439, PubMed:24243019, PubMed:27281220). The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro (PubMed:20107439, PubMed:24243019, PubMed:27281220). Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS (PubMed:8217843). Essential for the generation of olfactory and autonomic neurons (PubMed:8221886). Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation (PubMed:16020526, PubMed:17728344).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.