Ascl1 (NM_008553) Mouse Untagged Clone
CAT#: MC208938
Ascl1 (untagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1), (10ug)
"NM_008553" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ascl1 |
Synonyms | AI225900; ASH1; bHLHa46; Mash1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208938 representing NM_008553
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGAGCTCTGGCAAGATGGAGAGTGGAGCCGGCCAGCAGCCGCAGCCCCCGCAGCCCTTCCTGCCTC CCGCAGCCTGCTTCTTTGCGACCGCGGCGGCGGCGGCAGCGGCGGCGGCCGCGGCAGCTCAGAGCGCGCA GCAGCAACAGCCGCAGGCGCCGCCGCAGCAGGCGCCGCAGCTGAGCCCGGTGGCCGACAGCCAGCCCTCA GGGGGCGGTCACAAGTCAGCGGCCAAGCAGGTCAAGCGCCAGCGCTCGTCCTCTCCGGAACTGATGCGCT GCAAACGCCGGCTCAACTTCAGCGGCTTCGGCTACAGCCTGCCACAGCAGCAGCCGGCCGCCGTGGCGCG CCGCAACGAGCGCGAGCGCAACCGGGTCAAGTTGGTCAACCTGGGTTTTGCCACCCTCCGGGAGCATGTC CCCAACGGCGCGGCCAACAAGAAGATGAGCAAGGTGGAGACGCTGCGCTCGGCGGTCGAGTACATCCGCG CGCTGCAGCAGCTGCTGGACGAGCACGACGCGGTGAGCGCTGCCTTTCAGGCGGGCGTCCTGTCGCCCAC CATCTCCCCCAACTACTCCAACGACTTGAACTCTATGGCGGGTTCTCCGGTCTCGTCCTACTCCTCCGAC GAGGGATCCTACGACCCTCTTAGCCCAGAGGAACAAGAGCTGCTGGACTTTACCAACTGGTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_008553 |
Insert Size | 696 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC055748, AAH55748 |
RefSeq Size | 2028 bp |
RefSeq ORF | 696 bp |
Locus ID | 17172 |
UniProt ID | Q02067 |
Cytogenetics | 10 C1 |
Gene Summary | Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways (PubMed:24243019). Directly binds the E box motif (5'-CANNTG-3') on promoters and promotes transcription of neuronal genes (PubMed:20107439, PubMed:24243019, PubMed:27281220). The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro (PubMed:20107439, PubMed:24243019, PubMed:27281220). Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS (PubMed:8217843). Essential for the generation of olfactory and autonomic neurons (PubMed:8221886). Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation (PubMed:16020526, PubMed:17728344).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227072 | Ascl1 (tGFP-tagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1), (10ug) |
USD 500.00 |
|
MR227072 | Ascl1 (Myc-DDK-tagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1) |
USD 300.00 |
|
MR227072L1 | Lenti ORF clone of Ascl1 (Myc-DDK-tagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1) |
USD 600.00 |
|
MR227072L2 | Lenti ORF clone of Ascl1 (mGFP-tagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1) |
USD 600.00 |
|
MR227072L3 | Lenti ORF clone of Ascl1 (Myc-DDK-tagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1) |
USD 600.00 |
|
MR227072L4 | Lenti ORF clone of Ascl1 (mGFP-tagged) - Mouse achaete-scute complex homolog 1 (Drosophila) (Ascl1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review