Lfng (NM_008494) Mouse Untagged Clone

CAT#: MC208877

Lfng (untagged) - Mouse LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (Lfng), (10ug)


  "NM_008494" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lfng"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lfng
Synonyms AW061165
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208877 representing NM_008494
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCCAGCGGTGCGGCCGGCGCCTGCTGCTGGCGCTGGTGGGCGCGCTGTTGGCTTGTCTCCTGGTGC
TCACGGCCGACCCGCCACCGACTCCGATGCCCGCTGAGCGCGGACGGCGCGCGCTGCGTAGCCTGGCGGG
CTCCTCTGGAGGAGCTCCGGCTTCAGGGTCCAGGGCGGCTGTGGATCCCGGAGTCCTCACCCGCGAGGTG
CATAGCCTCTCCGAGTACTTCAGTCTACTCACCCGCGCGCGCAGAGACGCGGATCCACCGCCCGGGGTCG
CTTCTCGCCAGGGCGACGGCCATCCGCGTCCCCCCGCCGAAGTTCTGTCCCCTCGCGACGTCTTCATCGC
CGTCAAGACCACCAGAAAGTTTCACCGCGCGCGGCTCGATCTGCTGTTCGAGACCTGGATCTCGCGCCAC
AAGGAGATGACGTTCATCTTCACTGATGGGGAGGACGAAGCTCTGGCCAAGCTCACAGGCAATGTGGTGC
TCACCAACTGCTCCTCGGCCCACAGCCGCCAGGCTCTGTCCTGCAAGATGGCTGTGGAGTATGACCGATT
CATTGAGTCTGGGAAGAAGTGGTTCTGCCACGTGGATGATGACAACTACGTCAACCTCCGGGCGCTGCTG
CGGCTCCTGGCCAGCTATCCCCACACCCAAGACGTGTACATCGGCAAGCCCAGCCTGGACAGGCCCATCC
AGGCCACAGAACGGATCAGCGAGCACAAAGTGAGACCTGTCCACTTTTGGTTTGCCACCGGAGGAGCTGG
CTTCTGCATCAGCCGAGGGCTGGCCCTAAAGATGGGCCCATGGGCCAGTGGAGGACACTTCATGAGCACG
GCAGAGCGCATCCGGCTCCCCGATGACTGCACCATTGGCTACATTGTAGAGGCTCTGCTGGGTGTACCCC
TCATCCGGAGCGGCCTCTTCCACTCCCACCTAGAGAACCTGCAGCAGGTGCCCACCACCGAGCTTCATGA
GCAGGTGACCCTGAGCTATGGCATGTTTGAGAACAAGCGGAACGCAGTGCACATCAAGGGACCATTCTCT
GTGGAAGCTGACCCATCCAGGTTCCGCTCTGTCCATTGCCACCTGTACCCAGACACACCCTGGTGTCCTC
GCTCCGCCATCTTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008494
Insert Size 1137 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008494.3, NP_032520.1
RefSeq Size 2299 bp
RefSeq ORF 1137 bp
Locus ID 16848
UniProt ID O09010
Cytogenetics 5 79.15 cM
Gene Summary Glycosyltransferase that initiates the elongation of O-linked fucose residues attached to EGF-like repeats in the extracellular domain of Notch molecules. Modulates NOTCH1 activity by modifying O-fucose residues at specific EGF-like domains resulting in inhibition of NOTCH1 activation by JAG1 and enhancement of NOTCH1 activation by DLL1 via an increase in its binding to DLL1 (PubMed:28089369). Decreases the binding of JAG1 to NOTCH2 but not that of DLL1 (By similarity). Essential mediator of somite segmentation and patterning. During somite boundary formation, it restricts Notch activity in the presomitic mesoderm to a boundary-forming territory in the posterior half of the prospective somite. In this region, Notch function activates a set of genes that are involved in boundary formation and in anterior-posterior somite identity (PubMed:10330372). Ectopically expressed in the thymus, Lfgn inhibits Notch signaling which results in inhibition of T-cell commitment and promotes B-cell development in lymphoid progenitors (PubMed:11520458). May play a role in boundary formation of the enamel knot (PubMed:12167404).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.