Lfng (NM_008494) Mouse Untagged Clone

CAT#: MC208877

Lfng (untagged) - Mouse LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (Lfng), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Lfng (NM_008494) Mouse Untagged Clone
Symbol Lfng
Synonyms AW061165
Vector pCMV6-Entry
Sequence Data
>MC208877 representing NM_008494
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCCAGCGGTGCGGCCGGCGCCTGCTGCTGGCGCTGGTGGGCGCGCTGTTGGCTTGTCTCCTGGTGC
TCACGGCCGACCCGCCACCGACTCCGATGCCCGCTGAGCGCGGACGGCGCGCGCTGCGTAGCCTGGCGGG
CTCCTCTGGAGGAGCTCCGGCTTCAGGGTCCAGGGCGGCTGTGGATCCCGGAGTCCTCACCCGCGAGGTG
CATAGCCTCTCCGAGTACTTCAGTCTACTCACCCGCGCGCGCAGAGACGCGGATCCACCGCCCGGGGTCG
CTTCTCGCCAGGGCGACGGCCATCCGCGTCCCCCCGCCGAAGTTCTGTCCCCTCGCGACGTCTTCATCGC
CGTCAAGACCACCAGAAAGTTTCACCGCGCGCGGCTCGATCTGCTGTTCGAGACCTGGATCTCGCGCCAC
AAGGAGATGACGTTCATCTTCACTGATGGGGAGGACGAAGCTCTGGCCAAGCTCACAGGCAATGTGGTGC
TCACCAACTGCTCCTCGGCCCACAGCCGCCAGGCTCTGTCCTGCAAGATGGCTGTGGAGTATGACCGATT
CATTGAGTCTGGGAAGAAGTGGTTCTGCCACGTGGATGATGACAACTACGTCAACCTCCGGGCGCTGCTG
CGGCTCCTGGCCAGCTATCCCCACACCCAAGACGTGTACATCGGCAAGCCCAGCCTGGACAGGCCCATCC
AGGCCACAGAACGGATCAGCGAGCACAAAGTGAGACCTGTCCACTTTTGGTTTGCCACCGGAGGAGCTGG
CTTCTGCATCAGCCGAGGGCTGGCCCTAAAGATGGGCCCATGGGCCAGTGGAGGACACTTCATGAGCACG
GCAGAGCGCATCCGGCTCCCCGATGACTGCACCATTGGCTACATTGTAGAGGCTCTGCTGGGTGTACCCC
TCATCCGGAGCGGCCTCTTCCACTCCCACCTAGAGAACCTGCAGCAGGTGCCCACCACCGAGCTTCATGA
GCAGGTGACCCTGAGCTATGGCATGTTTGAGAACAAGCGGAACGCAGTGCACATCAAGGGACCATTCTCT
GTGGAAGCTGACCCATCCAGGTTCCGCTCTGTCCATTGCCACCTGTACCCAGACACACCCTGGTGTCCTC
GCTCCGCCATCTTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008494
ORF Size 1137 bp
Insert Size 1137
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008494.3, NP_032520
RefSeq Size 2299
RefSeq ORF 1137
Locus ID 16848
Cytogenetics 5 G2|5 79.15 cM
Gene Summary Glycosyltransferase that initiates the elongation of O-linked fucose residues attached to EGF-like repeats in the extracellular domain of Notch molecules inhibiting Jagged mediated Notch signaling. Essential mediator of somite segmentation and patterning. During somite boundary formation, it restricts Notch activity in the presomitic mesoderm to a boundary-formig territory in the posterior half of the prospective somite. In this region, Notch function activates a set of genes that are involved in boundary formation and in anterior-posterior somite identity. Ectopically expressed in the thymus, Lfgn inhibits Notch signaling which results in inhibition of T-cell commitment and promotes B-cell development in lymphoid progenitors. May play a role in boundary formation of the enamel knot. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.