Krtap19 (NM_010676) Mouse Untagged Clone

CAT#: MC208859

Krtap19 (untagged) - Mouse keratin associated protein 8-2 (Krtap8-2), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Krtap19 (NM_010676) Mouse Untagged Clone
Symbol Krtap19
Synonyms Krtap8-2
Vector pCMV6-Entry
Sequence Data
>MC208859 representing NM_010676
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTACTACGGCAGCTACTACGGAGGTCTGGGCTCTGGCATCCGAGGCTTTGGGAACCTGGGTTATG
GCTATGGCTGTGGCTGTGGCTTTGGAGGTTACGGATATGGATCTGGCTATGGCAGATATGGATATGGCTA
CCGCCGCCCCCTTTATTATGGAGGATATGGATTCTCCCGATTCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_010676
ORF Size 189 bp
Insert Size 189
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_010676.2, NP_034806
RefSeq Size 482
RefSeq ORF 189
Locus ID 16704
Cytogenetics 16|16 C3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.