Klk1b26 (NM_010644) Mouse Untagged Clone

CAT#: MC208826

Klk1b26 (untagged) - Mouse kallikrein 1-related petidase b26 (Klk1b26), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Klk1b26
• Synonyms: Egfbp; Egfbp2; Klk2; Klk26; mGK-26; mGK26; PRECE; PRECE-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208826 representing NM_010644
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTGGTTCCTGATCCTGTTCCCAGCCCTGTCCCTAGGAGGGATTGATGCTGCACCTCCTCTCCAGTCTC
  GGGTGGTTGGAGGATTTAACTGTGAGAAGAATTCCCAACCCTGGCAGGTGGCTGTGTACTACCAAAAGGA
  ACACATTTGTGGGGGTGTCCTGTTGGACCGCAACTGGGTTCTCACAGCTGCCCACTGCTATGTCGACCAG
  TATGAGGTTTGGCTGGGCAAAAACAAGTTATTCCAAGAGGAACCCTCTGCTCAGCACCGATTGGTCAGCA
  AAAGCTTCCCTCACCCTGGCTTCAACATGAGCCTCCTGATGCTTCAAACAACACCTCCTGGGGCTGACTT
  CAGCAATGACCTGATGCTGCTCCGCCTCAGCAAGCCTGCTGACATCACAGATGTTGTGAAGCCCATCGCC
  CTGCCCACAAAGGAGCCCAAGCCGGGGAGCACATGCCTAGCCTCAGGCTGGGGCAGCATTACACCCACAA
  GATGGCAAAAGTCAGATGATCTTCAGTGTGTGTTCATCACGCTCCTCCCCAATGAGAACTGTGCCAAAGT
  CTACCTACAGAAAGTCACAGATGTCATGCTGTGTGCAGGAGAGATGGGTGGAGGCAAAGACACTTGTGCG
  GGTGACTCCGGAGGCCCACTGATTTGTGATGGTATTCTCCAAGGAACCACATCAAATGGCCCTGAACCAT
  GCGGTAAACCTGGTGTACCAGCCATCTACACCAACCTTATTAAGTTCAACTCCTGGATAAAAGATACTAT
  GATGAAAAATGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010644
• Insert Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010644.3, NP_034774.1
• RefSeq Size: 877 bp
• RefSeq ORF: 786 bp
• Locus ID: 16618
• UniProt ID: P36369
• Cytogenetics: 7 28.5 cM
• Gene Summary: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]