Il3ra (NM_008369) Mouse Untagged Clone

CAT#: MC208782

Il3ra (untagged) - Mouse interleukin 3 receptor, alpha chain (Il3ra), (10ug)

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Il3ra (NM_008369) Mouse Untagged Clone
Symbol Il3ra
Synonyms CD123; CDw123; SUT-1
Vector pCMV6-Entry
Sequence Data
>MC208782 representing NM_008369
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCCAACCTGTGGCTCATCCTGGGGCTCCTGGCATCCCACTCTTCAGATCTGGCTGCGGTCCGTG
AGGCTCCACCCACTGCTGTGACCACGCCCATCCAGAACCTGCATATCGACCCCGCCCACTACACACTGAG
CTGGGACCCCGCCCCCGGCGCTGACATCACGACAGGGGCTTTTTGCAGGAAGGGCAGGGACATCTTTGTC
TGGGCTGACCCCGGGCTTGCCCGCTGCTCATTCCAGTCGCTCTCCCTCTGCCATGTGACCAACTTCACCG
TCTTCCTGGGGAAGGACAGGGCTGTGGCAGGATCCATCCAGTTCCCCCCAGATGATGATGGCGACCACGA
GGCCGCAGCCCAGGACCTGCGCTGCTGGGTGCATGAGGGGCAGCTGAGCTGCCAATGGGAGCGGGGTCCG
AAAGCAACGGGTGACGTGCACTACCGGATGTTCTGGCGTGATGTGCGGCTCGGTCCTGCCCACAACCGCG
AGTGTCCACACTACCACAGCCTTGATGTCAACACCGCTGGCCCCGCCCCTCATGGTGGCCATGAAGGCTG
CACCCTTGACCTCGACACTGTCCTTGGCTCCACCCCCAACAGCCCTGACCTTGTCCCCCAGGTCACCATC
ACCGTCAACGGCAGTGGCCGCGCTGGCCCCGTGCCCTGCATGGACAACACTGTGGACCTGCAGCGCGCAG
AGGTCCTGGCCCCGCCCACGTTGACAGTGGAGTGCAACGGCTCTGAGGCCCATGCCCGATGGGTCGCGCG
GAACAGATTCCACCATGGCCTCCTTGGGTACACCCTGCAGGTCAACCAGAGCTCCCGCTCAGAGCCACAG
GAATACAATGTCTCCATCCCCCACTTCTGGGTCCCCAACGCTGGTGCCATCTCCTTCCGGGTCAAGTCGA
GGTCAGAGGTTTACCCTCGGAAGCTCAGCAGCTGGAGCGAAGCCTGGGGCCTCGTCTGCCCCCCAGAGGT
GATGCCTGTGAAGACAGCCTTGGTGACTTCAGTGGCTACGGTGCTGGGGGCAGGGCTCGTGGCAGCTGGG
CTCCTGCTGTGGTGGAGGAAGTCGCTGCTCTACCGCCTGTGCCCACCCATTCCACGCCTGCGCCTGCCCT
TGGCAGGGGAGATGGTCGTGTGGGAACCAGCTCTTGAAGACTGCGAGGTGACGCCTGTGACAGACGCCTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008369
ORF Size 1191 bp
Insert Size 1191
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008369.1, NP_032395
RefSeq Size 1394
RefSeq ORF 1191
Locus ID 16188
Cytogenetics 14 A1|14 7.08 cM
Gene Summary In mouse, there are two classes of high-affinity IL3 receptors. One contains an IL3-specific beta subunit and the other contains the beta subunit also shared by high-affinity IL5 and GM-CSF receptors. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.