Il18r1 (NM_001161842) Mouse Untagged Clone

CAT#: MC208778

Il18r1 (untagged) - Mouse interleukin 18 receptor 1 (Il18r1), transcript variant 2, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Il18r1 (NM_001161842) Mouse Untagged Clone
Symbol Il18r1
Synonyms Il18ralpha; Il1rrp
Vector pCMV6-Entry
Sequence Data
>MC208778 representing NM_001161842
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATCATGAAGAATTAATCTTGACACTCTGCATTCTCATTGTTAAAAGTGCCTCAAAAAGTTGTATTC
ACCGATCACAAATTCATGTGGTAGAGGGAGAACCTTTTTATCTGAAGCCATGTGGCATATCTGCACCAGT
GCACAGGAATGAAACAGCCACCATGAGATGGTTCAAAGGCAGTGCTTCACATGAGTATAGAGAGCTGAAC
AACAGAAGCTCGCCCAGAGTCACTTTTCATGATCACACCTTGGAATTCTGGCCAGTTGAGATGGAGGATG
AGGGAACGTACATTTCTCAAGTCGGAAATGATCGTCGCAATTGGACCTTAAATGTCACCAAAAGAAACAA
ACACAGCTGTTTCTCTGACAAGCTCGTGACAAGCAGAGATGTTGAAGTTAACAAATCTCTGCATATCACT
TGTAAGAATCCTAACTATGAAGAGCTGATCCAGGACACATGGCTGTATAAGAACTGTAAGGAAATATCCA
AAACCCCAAGGATCCTGAAGGATGCCGAGTTTGGAGATGAGGGCTACTACTCCTGCGTGTTTTCTGTCCA
CCATAATGGGACACGGTACAACATCACCAAGACTGTCAATATAACAGTTATTGAAGGAAGGAGTAAAGTA
ACTCCAGCTATTTTAGGACCAAAGTGTGAGAAGGTTGGTGTAGAACTAGGAAAGGATGTGGAGTTGAACT
GCAGTGCTTCATTGAATAAAGACGATCTGTTTTATTGGAGCATCAGGAAAGAGGACAGCTCAGACCCTAA
TGTGCAAGAAGACAGGAAGGAGACGACAACATGGATTTCTGAAGGCAAACTGCATGCTTCAAAAATACTG
AGATTTCAGAAAATTACTGAAAACTATCTCAATGTTTTATATAATTGCACCGTGGCCAACGAAGAAGCCA
TAGACACCAAGAGCTTCGTCTTGGTGAGAAAAGAAATACCTGATATCCCAGGCCATGTCTTTACAGGAGG
AGTAACTGTGCTTGTTCTCGCCTCTGTGGCAGCAGTGTGTATAGTGATTTTGTGTGTCATTTATAAAGTT
GACTTGGTTCTGTTCTATAGGCGCATAGCGGAAAGAGACGAGACACTAACAGGTAATATGCTGCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001161842
ORF Size 1119 bp
Insert Size 1119
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001161842.1, NP_001155314
RefSeq Size 1919
RefSeq ORF 1119
Locus ID 16182
Cytogenetics 1|1 B
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.