Dnaja1 (NM_001164671) Mouse Untagged Clone

CAT#: MC208721

Dnaja1 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily A, member 1 (Dnaja1), transcript variant 1, (10ug)


  "NM_001164671" in other vectors (4)

Reconstitution Protocol

USD 732.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-Dnaja1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dnaja1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dnaja1
Synonyms Hsj; HSJ-2; Hsj2; Nedd; Nedd7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208721 representing NM_001164671
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAAGAAACCACTTACTACGATGTTTTGGGGGTAAAACCCAATGCCACCCAGGAAGAATTGAAAA
AGGCATATAGAAAATTGGCCTTGAAGTACCACCCTGATAAGAATCCAAATGAAGGGGAAAAGTTTAAACA
GATTTCTCAAGCTTATGAAGTTCTTGCTGATTCCAAAAAAAGGGAACTATATGATAAAGGAGGGGAGCAG
GCGATTAAAGAGGGCGGAGCAGGTGGTGGTTTTGGCTCACCCATGGATATCTTTGATATGTTCTTTGGAG
GAGGAGGAAGAATGCAAAGAGAAAGGAGAGGTAAAAATGTTGTTCATCAGCTCTCAGTGACCTTAGAAGA
CTTATATAATGGTGCAACAAGAAAACTGGCTCTGCAAAAGAATGTGATTTGTGACAAATGTGAAGGCCGA
GGTGGTAAGAAAGGAGCAGTAGAGTGCTGTCCCAACTGCCGGGGGACAGGTATGCAGATAAGGATTCATC
AGATTGGACCAGGAATGGTTCAGCAAATTCAGTCAGTGTGCATGGAGTGCCAGGGTCATGGAGAACGCAT
CAGTCCAAAAGACAGATGTAAAAGCTGCAATGGAAGAAAAATAGTTCGAGAGAAGAAAATTTTAGAAGTT
CATATTGATAAAGGCATGAAAGATGGTCAGAAGATAACATTCCACGGTGAAGGAGACCAAGAACCAGGAC
TGGAGCCAGGAGATATTATCATTGTGTTAGATCAGAAGGACCATGCTGTTTTTACAAGGCGAGGAGAAGA
CCTTTTCATGTGTATGGACATACAGCTGGTTGAAGCATTGTGCGGCTTCCAAAAGCCAATATCTACTCTT
GACAACCGAACCATAGTCATCACCTCTCATCCAGGTCAGATTGTCAAGCATGGGGATATAAAATGTGTGC
TAAATGAAGGTATGCCAATATACCGTCGGCCATATGAAAAGGGACGTCTAATCATTGAGTTTAAGGTAAA
CTTTCCTGAAAATGGCTTTCTCTCTCCTGATAAACTCTCTTTGCTGGAAAAACTCCTTCCTGAAAGGAAG
GAAGTAGAAGAGACTGATGAAATGGATCAGGTAGAACTGGTGGACTTTGATCCAAATCAGGAAAGACGGC
GTCATTATAATGGAGAAGCGTATGAGGATGATGAACATCACCCCAGAGGTGGCGTTCAGTGTCAGACCTC
TTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164671
Insert Size 1194 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164671.2, NP_001158143.1
RefSeq Size 3459 bp
RefSeq ORF 1194 bp
Locus ID 15502
UniProt ID P63037
Cytogenetics 4 A5
Gene Summary The protein encoded by this gene is a member of the DnaJ family, whose members act as cochaperones of heat shock protein 70. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. Mice deficient for this gene display reduced levels of activation‐induced deaminase, an enzyme that deaminates deoxycytidine at the immunoglobulin genes during immune responses. In addition, mice lacking this gene exhibit severe defects in spermatogenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.