Hes2 (NM_008236) Mouse Untagged Clone
CAT#: MC208657
Hes2 (untagged) - Mouse hairy and enhancer of split 2 (Drosophila) (Hes2), (10ug)
"NM_008236" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hes2 |
Synonyms | HES-; HES-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208657 representing NM_008236
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCTGCCCAGAAGAGTTGAGGACGCGGCGGAGCTGCGCAAGAACCTAAAGCCGCTGCTGGAGAAGC GCCGGCGCGCGCGGATCAACGAGAGCCTAAGCCAGCTGAAGGGTCTCGTATTGCCGCTGCTGGGCGCGGA GACTTCCCGCTCTTCGAAGTTGGAGAAGGCAGACATCCTGGAAATGACTGTGCGCTTCCTACAGGAGCAG CCTGCGACCCTGTACTCCTCTGCAGCACCTGGGCCTTTGAATAGCTACCTCGAGGGTTACCGAGCCTGTC TGGCGCGACTGGCCCGCGTACTGCCCGCCTGCAGCGTCCTGGAGCCCGCAGTGAGCGCGCGCCTACTAGA GCACCTGCGACAGAGGACTGTCAGTGATGACTCGCCCTCACTGACGCTACCACCCGCTCCAGCTCCAGCT CCTTCTCCGCCGGTGCCTCCTCCAGGCAGTTCTGGCCTTTGGAGGCCATGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008236 |
Insert Size | 474 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008236.4, NP_032262.2 |
RefSeq Size | 2521 bp |
RefSeq ORF | 474 bp |
Locus ID | 15206 |
UniProt ID | O54792 |
Cytogenetics | 4 82.92 cM |
Gene Summary | The protein encoded by this gene belongs to the mammalian Hes gene family, the mammalian homologues of Drosophila hairy and Enhancer of split. Hes 2 is a basic helix-loop-helix transcriptional repressor and is an effector of the Notch signaling pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221900 | Hes2 (tGFP-tagged) - Mouse hairy and enhancer of split 2 (Drosophila) (Hes2), (10ug) |
USD 425.00 |
|
MR221900 | Hes2 (Myc-DDK-tagged) - Mouse hairy and enhancer of split 2 (Drosophila) (Hes2) |
USD 225.00 |
|
MR221900L3 | Lenti ORF clone of Hes2 (Myc-DDK-tagged) - Mouse hairy and enhancer of split 2 (Drosophila) (Hes2) |
USD 525.00 |
|
MR221900L4 | Lenti ORF clone of Hes2 (mGFP-tagged) - Mouse hairy and enhancer of split 2 (Drosophila) (Hes2) |
USD 525.00 |
{0} Product Review(s)
Be the first one to submit a review