H13 (NM_001159553) Mouse Untagged Clone
CAT#: MC208617
H13 (untagged) - Mouse histocompatibility 13 (H13), transcript variant 4, (10ug)
"NM_001159553" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | H13 |
Synonyms | 1200006O09Rik; 4930443L17Rik; 5031424B04Rik; AV020344; H-13; Hm13; PSL3; Spp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208617 representing NM_001159553
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATTCGGCTGTCAGCGATCCGCACAACGGCAGCGCCGAGGCTGGCACCCCAGCCAACGGCACGACGC GGCCGCCCTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTCCTGCTCATGGCGCTGCTGCCCAT CTTCTTCGGCGCCCTGCGCTCGGTGCGCTGCGCCCGCGGCAAGAGCTCTTCGGACATGCCAGAAACCATC ACCAGTCGAGATGCCGCCCGCTTCCCCATCATCGCCAGCTGCACACTCCTGGGGCTCTACCTCTTTTTCA AAATATTCTCCCAGGAGTACATCAACCTCTTGCTGTCCATGTATTTCTTCGTGCTGGGGATCCTGGCCCT GTCACACACCATCAGGTCAGAAGGCATCTCTCGACAGCCTTTGAAGCTGCTTTCTCAGGAGCCAGTACAG GGTCTTGGATGGGAACATGGTCTTTTGTGTCATTCAGAGCCAGGTTTAAATCCTGGCTGTAAAATCCAAG GGAATCTTCCCTCACGTCAGCACTATACGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159553 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001159553.1, NP_001153025.1 |
RefSeq Size | 4499 bp |
RefSeq ORF | 522 bp |
Locus ID | 14950 |
UniProt ID | Q9D8V0 |
Cytogenetics | 2 75.41 cM |
Gene Summary | Catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein, resulting in the release of the fragment from the ER membrane into the cytoplasm. Required to generate lymphocyte cell surface (HLA-E) epitopes derived from MHC class I signal peptides. Involved in the intramembrane cleavage of the integral membrane protein PSEN1. Cleaves the integral membrane protein XBP1 isoform 1 in a DERL1/RNF139-dependent manner (By similarity). May play a role in graft rejection (PubMed:9354467).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (4) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217089 | H13 (tGFP-tagged) - Mouse histocompatibility 13 (H13) transcript variant 4, (10ug) |
USD 530.00 |
|
MR217089 | H13 (Myc-DDK-tagged) - Mouse histocompatibility 13 (H13), transcript variant 4 |
USD 330.00 |
|
MR217089L3 | Lenti ORF clone of H13 (Myc-DDK-tagged) - Mouse histocompatibility 13 (H13), transcript variant 4 |
USD 630.00 |
|
MR217089L4 | Lenti ORF clone of H13 (mGFP-tagged) - Mouse histocompatibility 13 (H13), transcript variant 4 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review