Grb2 (NM_008163) Mouse Untagged Clone

CAT#: MC208597

Grb2 (untagged) - Mouse growth factor receptor bound protein 2 (Grb2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Grb2
• Synonyms: AA408164; Ash
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208597 representing NM_008163
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCTGACGATGAGCTGAGCTTCAAAAGGGGGGACA
  TCCTTAAGGTTTTGAATGAAGAATGTGACCAGAACTGGTATAAGGCAGAACTCAATGGGAAAGATGGCTT
  CATCCCCAAGAATTACATAGAAATGAAACCACATCCGTGGTTTTTTGGCAAAATCCCCAGAGCCAAGGCA
  GAAGAAATGCTCAGCAAACAGCGGCATGACGGGGCCTTCCTGATCCGAGAGAGCGAGAGCGCTCCTGGGG
  ACTTCTCCCTGTCCGTCAAGTTTGGAAATGATGTGCAGCACTTCAAGGTGCTCCGCGACGGAGCCGGGAA
  GTATTTCCTGTGGGTGGTGAAGTTTAATTCTTTGAATGAGCTGGTAGATTACCACAGATCAACATCCGTG
  TCCAGGAACCAGCAGATATTCTTACGGGACATAGAACAGATGCCACAGCAGCCAACCTACGTCCAGGCGC
  TCTTTGACTTTGACCCCCAGGAGGATGGCGAGCTGGGCTTTCGCAGAGGAGACTTCATTCATGTCATGGA
  TAACTCAGATCCCAATTGGTGGAAAGGGGCCTGCCACGGGCAGACCGGCATGTTTCCCCGCAATTATGTC
  ACCCCAGTGAACCGGAACGTCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008163
• Insert Size: 654 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_008163.4, NP_032189.1
• RefSeq Size: 2725 bp
• RefSeq ORF: 654 bp
• Locus ID: 14784
• UniProt ID: Q60631
• Cytogenetics: 11 80.91 cM
• Gene Summary: The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Three alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.