Gclm (NM_008129) Mouse Untagged Clone

CAT#: MC208559

Reviews ()
Write a review

Gclm (untagged) - Mouse glutamate-cysteine ligase, modifier subunit (Gclm), (10ug)



Reconstitution Protocol

USD 473.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gclm
Synonyms AI649393; Gcmc; Glclr
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208559 representing NM_008129
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCACCGACAGCCGCGCGGCCGGGGCGCTCCTGGCGCGGGCCAGCACCCTGCACCTGCAGACCGGGA
ACCTGCTCAACTGGGGCCGCCTGCGAAAAAAGTGCCCGTCCACGCACAGCGAGGAGCTTCGGGACTGTAT
CCAAAAGACCTTGAATGAATGGAGTTCCCAAATCAGCCCCGATTTAGTCAGGGAGTTTCCAGATGTTTTG
GAATGCACCATGTCCCATGCAGTGGAGAAGATAAATCCCGATGAAAGAGAAGAAATGAAAGTTTCTGCAA
AACTGTTCATTGTAGGATCGAATTCTTCATCATCAACTAGAAGTGCAGTTGACATGGCATGCTCCGTCCT
TGGAGTTGCACAGCTGGACTCTGTGATCATGGCTTCGCCTCCGATTGAAGATGGAGTTAATCTTTCCTTG
GAGCATTTACAGCCTTACTGGGAGGAATTAGAGAACTTAGTTCAGAGCAAGAAAATTGTTGCTATAGGCA
CCTCTGATCTAGACAAGACACAGTTGGAGCAGCTGTATCAGTGGGCACAGGTAAAACCCAATAGTAACCA
AGTTAACCTGGCCTCCTGCTGTGTGATGCCACCAGATTTGACTGCCTTTGCTAAACAATTTGACATACAG
CTACTGACTCACAATGACCCGAAAGAACTGCTCTCTGAGGCAAGTTTCCAGGAAGCTCTTCAAGAAAGCA
TCCCTGACATTGAAGCCCAGGATTGGGTGCCGCTGTGGCTGCTGAGGTACTCGGTCATCGTGAAGAGCAG
GGGAATCATCAAGTCTAAAGGCTACATTCTGCAAGCCAAAAGGAGGGGCTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_008129
Insert Size 825 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008129.4, NP_032155.1
RefSeq Size 2072 bp
RefSeq ORF 825 bp
Locus ID 14630
UniProt ID O09172
Cytogenetics 3 52.94 cM
Other products for "Gclm"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.