Gdnf (NM_010275) Mouse Untagged Clone

SKU
MC208539
Gdnf (untagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), (10ug)
  $450.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gdnf
Synonyms AI385739; ATF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208539 representing NM_010275
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGATTCGGGCCACTTGGAGTTAATGTCCAACTGGGGGTCTACGGAGACCGGATCCGAGGTGCCGCCG
CCGGACGGGACTCTAAGATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGTTGCTCCACACCGCGTC
TGCCTTCCCGCTGCCCGCCGGTAAGAGGCTTCTCGAAGCGCCCGCTGAAGACCACTCCCTCGGCCACCGC
CGCGTGCCCTTCGCGCTGACCAGTGACTCCAATATGCCTGAAGATTATCCTGACCAGTTTGATGACGTCA
TGGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAGCGGCAGCGCTTCCTCG
AAGAGAGAGGAATCGGCAGGCTGCAGCTGCCAGCCCAGAGAATTCCAGAGGGAAAGGTCGCAGAGGCCAG
AGGGGCAAAAATCGGGGGTGCGTTTTAACTGCCATACACTTAAATGTCACTGACTTGGGTTTGGGCTATG
AAACCAAGGAGGAACTGATCTTTCGATATTGCAGCGGTTCCTGTGAATCGGCCGAGACAATGTATGACAA
AATACTAAAAAACCTGTCTCGGAGTAGAAGGCTAACAAGTGACAAAGTAGGCCAGGCATGTTGCAGGCCG
GTCGCCTTCGACGACGACCTGTCGTTTTTAGATGACAACCTGGTTTACCATATTCTAAGAAAGCATTCCG
CTAAACGGTGTGGATGTATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_010275
Insert Size 723 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC119031, AAI19032
RefSeq Size 4477 bp
RefSeq ORF 723 bp
Locus ID 14573
UniProt ID P48540
Cytogenetics 15 A1
Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. provided by RefSeq, Aug 2016
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010275" in other vectors (4)
SKU Description Size Price
MG227554 Gdnf (tGFP-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), (10ug) 10 ug
$650.00
MR227554 Gdnf (Myc-DDK-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf) 10 ug
$450.00
MR227554L3 Lenti ORF clone of Gdnf (Myc-DDK-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf) 10 ug
$750.00
MR227554L4 Lenti ORF clone of Gdnf (mGFP-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf) 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products