G6pc2 (NM_021331) Mouse Untagged Clone

CAT#: MC208518

G6pc2 (untagged) - Mouse glucose-6-phosphatase, catalytic, 2 (G6pc2), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name G6pc2 (NM_021331) Mouse Untagged Clone
Symbol G6pc2
Synonyms G6pc-rs; IGRP
Vector pCMV6-Entry
Sequence Data
>MC208518 representing NM_021331
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTTCCTTCATAGGAGTGGAGTGCTTATTATTCATCATCTGCAGGAGGACTACCGGACTTACTATG
GTTTTCTAAATTTTATGTCCAATGTTGGAGACCCCCGAAATATCTTTTCTATTTACTTCCCACTTTGGTT
TCAGTTGAATCAGAATGTTGGAACCAAGATGATCTGGGTAGCGGTCATAGGGGACTGGTTCAATCTCATA
TTTAAATGGATATTGTTTGGCCATCGTCCTTACTGGTGGATACAAGAAACTGAGATTTATCCAAATCATT
CAAGCCCATGTCTTGAGCAGTTTCCTACTACGTGTGAAACAGGCCCAGGAAGTCCATCTGGCCACGCAAT
GGGCTCATCGTGCGTCTGGTATGTCATGGTAACAGCTGCCCTAAGCTACACCATCAGCCGGATGGAGGAG
TCCTCTGTCACTCTGCACAGACTGACCTGGTCCTTTCTGTGGAGTGTTTTCTGGTTGATTCAAATCAGCG
TCTGCATCTCAAGAGTATTCATAGCCACACATTTCCCCCATCAGGTCATTCTTGGAGTGATTGGTGGGAT
GCTAGTAGCCGAGGCCTTTGAACACACTCCAGGAGTCCACATGGCCAGCTTGAGTGTGTACCTGAAGACC
AACGTCTTCCTCTTCCTGTTTGCCCTCGGCTTTTACCTGCTTCTCCGACTGTTCGGTATTGACCTGCTGT
GGTCCGTGCCCATCGCCAAAAAGTGGTGTGCCAACCCAGACTGGATCCACATTGACAGCACGCCTTTTGC
TGGACTCGTGAGAAACCTCGGGGTCCTCTTTGGCTTGGGTTTCGCCATCAACTCAGAAATGTTCCTTCGG
AGCTGCCAGGGAGAAAATGGCACCAAGCCGAGCTTCCGCTTGCTCTGTGCTCTGACCTCACTGACCACAA
TGCAACTTTATCGCTTCATCAAGATCCCGACTCACGCGGAACCTTTATTTTACCTGTTGTCTTTCTGTAA
AAGTGCGTCCATCCCCCTGATGGTGGTGGCTCTAATTCCCTACTGTGTACATATGTTAATGAGACCCGGT
GACAAGAAGACTAAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_021331
ORF Size 1068 bp
Insert Size 1068
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021331.4, NP_067306
RefSeq Size 2066
RefSeq ORF 1068
Locus ID 14378
Cytogenetics 2 C2|2 39.66 cM
Gene Summary This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.