Fdx1 (NM_007996) Mouse Untagged Clone

SKU
MC208476
Fdx1 (untagged) - Mouse ferredoxin 1 (Fdx1), nuclear gene encoding mitochondrial protein, (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fdx1
Synonyms ADRE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208476 representing NM_007996
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCCGCTCCGGGCGCCCGACTCCTGCGCGCGGCCTGCGCCTCCGTCCCTTTCCGCGGCCTTGACC
GCTGTCGGCTGCTGGTCTGCGGGACCGGAGCGGGAACTGCCATCTCTCCGTGGACCCCGAGTCCCCGCCT
GCATGCAGAGGCCGGGCCCGGCCGGCCGCTGAGCGTGTCTGCGCGCGCGCGGAGCAGCTCAGAAGATAAG
ATAACAGTCCACTTCAAGAACCGAGATGGCGAGACGCTAACGACCAAGGGGAAAATTGGCGACTCTCTGC
TAGATGTTGTGATTGAGAACAACTTAGATATCGATGGGTTTGGTGCGTGTGAGGGAACGTTGGCTTGCTC
TACTTGTCATCTTATCTTTGAGGATCACATCTATGAGAAGTTAGATGCCATTACTGATGAAGAGAATGAC
ATGCTTGACCTGGCTTTTGGACTAACAGACAGGTCAAGGTTGGGCTGCCAAGTTTGTCTGACCAAGGCTA
TGGACAATATGACTGTGCGTGTGCCTGAAGCAGTGGCGGATGTCCGACAGTCTGTTGACATGAGCAAGAA
TTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_007996
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007996.2, NP_032022.1
RefSeq Size 1227 bp
RefSeq ORF 567 bp
Locus ID 14148
UniProt ID P46656
Cytogenetics 9 A5.3
Summary Ferrodoxins are iron-sulfur proteins that facilitate monooxygenase reactions catalyzed by P450 enzymes. The protein encoded by this gene is present in the mitochondrial matrix and transfers electrons from ferredoxin reductase to steroidogenic mitochondrial cytochrome P450 proteins. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Sep 2014
Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007996" in other vectors (4)
SKU Description Size Price
MG220323 Fdx1 (tGFP-tagged) - Mouse ferredoxin 1 (Fdx1) nuclear gene encoding mitochondrial protein, (10ug) 10 ug
$500.00
MR220323 Fdx1 (Myc-DDK-tagged) - Mouse ferredoxin 1 (Fdx1), nuclear gene encoding mitochondrial protein 10 ug
$289.00 $300.00
MR220323L3 Lenti ORF clone of Fdx1 (Myc-DDK-tagged) - Mouse ferredoxin 1 (Fdx1), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR220323L4 Lenti ORF clone of Fdx1 (mGFP-tagged) - Mouse ferredoxin 1 (Fdx1), nuclear gene encoding mitochondrial protein 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products